Entry information : ClunAPx-CcP01
Entry ID 12024
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ClunAPx-CcP01
Name ClunAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus lunatus (Curvularia lunata)    [TaxId: 5503 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ClunAPx-CcP01
start..stop
S start..stop
COsaAPx-CcP01 897 0 1..529 1..530
CheAPx-CcP01_C4 880 0 1..529 1..530
PterAPx-CcP01 802 0 17..529 16..527
PtritAPx-CcP01 791 0 1..529 1..526
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 330788..331178 391 N° 2 331249..332447 1199  
join(330788..331178,331249..332447)


exon

Literature and cross-references ClunAPx-CcP01
DNA ref. JGI genome:   scaffold_4 (330788..332447)
Cluster/Prediction ref. JGI gene:   105227
Protein sequence: ClunAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   530 (509)
PWM (Da):   %s   55519.72 (53232.5)  
PI (pH):   %s   5.26 (5.12) Peptide Signal:   %s   cut: 21 range:21-529
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLTLFKIATAAAVFVPRAEAALYYPSTQTHLLEHILVDNWGAYASNFSSAITPCDRYVTQTGTAARTSGRTTAAQWMRVLFHDFITANVSAGTGGVDASIGFETAREENKGSAFNDSFTFWRPFVNGAVSMADLIAVGTVMSNNLCGGNNMPYRAGRIDALSAGSTTGVPAPETSLEETLVFFERAGFDKVDSIGLTACGHTMGSVHHGGFPDVVDESFVTPNNTNGGSNFDTTRGVFDPKVVGEYVHWTGNKGGPLVTSFNESMNSDLRLYESDNNATMRALLAQGPAFLDTCVELMRRAIDTVPSGVELGDVITAIPVKPVNVTYDYSKTDGKLVFSGKIRVLTVAGAKAPNSLTLHMGKHDTTTHLTAESETGQSVFGRGAAGYGTTTYFPFSLSGPALQNASSFSVRGEGIKQDFPVSSQAFVVPSLTALEGKGFNVTVAVAGSASCTDVNVRVAAPFTQPLTLAPKISKKDVGLNAVAGTLDGYTLCGGNIVLDAVPTGLLTVEALLGEKAVDTLLVDGGRAGW

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGACCTTGTTCAAAATTGCGACTGCGGCCGCAGTATTTGTGCCCAGGGCCGAAGCAGCACTTTACTACCCCAGCACCCAAACGCATCTCCTGGAACACATTCTCGTCGACAACTGG
GGAGCATATGCGTCTAACTTCTCATCTGCAATCACTCCCTGTGACCGCTATGTGACACAGACCGGGACCGCAGCCCGCACCAGTGGCCGCACCACAGCAGCGCAGTGGATGCGTGTTCTT
TTCCATGACTTCATCACGGCCAATGTGAGCGCGGGTACGGGCGGCGTGGATGCAAGCATAGGGTTTGAAACAGCCAGAGAAGAGAACAAGGGGAGTGCCTTCAACGACAGTTTTACTTTT
TGGAGACCGTTTGTGAATGGCGCGGTTTCTA
GTATGTTTGTTGATTTTATTTATTTCTGGCCTTTTAAGCAATATGGTTTACTGACGGAATATTCCTCCAGTGGCGGATCTGATTGCGGT
GGGAACTGTCATGTCGAACAACCTATGTGGAGGAAACAACATGCCGTACCGTGCTGGACGGATCGATGCTCTCTCAGCGGGTTCTACAACGGGCGTCCCAGCACCAGAGACGAGCCTCGA
GGAAACGCTCGTCTTTTTCGAGCGCGCAGGATTCGACAAGGTAGACTCCATTGGGCTCACAGCATGTGGCCACACCATGGGTTCTGTGCATCACGGCGGCTTCCCTGATGTCGTAGACGA
ATCCTTTGTCACGCCCAACAACACCAATGGTGGCAGCAACTTTGACACCACCCGTGGCGTCTTCGATCCAAAGGTTGTGGGAGAATACGTCCATTGGACTGGTAACAAAGGCGGTCCCTT
GGTCACTTCGTTCAATGAGTCCATGAACTCTGACCTCCGGCTCTACGAGAGCGACAACAACGCTACCATGCGAGCTCTGCTCGCCCAAGGACCAGCATTCCTAGACACATGTGTGGAACT
CATGCGCCGTGCCATCGATACCGTGCCCTCTGGCGTAGAACTTGGGGATGTCATCACAGCCATTCCTGTAAAGCCCGTCAATGTGACGTACGATTACTCCAAGACAGATGGCAAATTGGT
CTTCTCCGGAAAGATCAGGGTATTGACTGTAGCGGGCGCCAAAGCCCCCAACTCACTCACGCTTCACATGGGCAAGCATGATACCACCACCCATCTCACTGCAGAATCAGAAACAGGGCA
ATCTGTTTTTGGTCGCGGTGCTGCTGGATACGGAACAACGACATATTTTCCCTTTTCCCTATCCGGACCCGCACTCCAGAATGCAAGTTCCTTCTCTGTGCGTGGCGAGGGTATTAAGCA
AGATTTTCCTGTTAGCAGTCAAGCATTCGTGGTGCCGAGCTTGACGGCTTTGGAGGGTAAGGGATTCAACGTTACCGTTGCTGTGGCGGGATCTGCCTCTTGCACAGATGTAAACGTGCG
TGTTGCTGCTCCGTTTACGCAACCCTTGACTTTGGCACCCAAAATCAGCAAGAAGGATGTTGGGTTAAACGCTGTGGCAGGGACATTGGATGGTTACACTCTCTGTGGTGGTAACATCGT
GCTAGACGCCGTACCAACTGGTTTACTTACCGTGGAAGCTTTGCTTGGAGAAAAAGCTGTAGACACACTGTTGGTAGATGGAGGAAGGGCAGGGTGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGACCTTGTTCAAAATTGCGACTGCGGCCGCAGTATTTGTGCCCAGGGCCGAAGCAGCACTTTACTACCCCAGCACCCAAACGCATCTCCTGGAACACATTCTCGTCGACAACTGG
GGAGCATATGCGTCTAACTTCTCATCTGCAATCACTCCCTGTGACCGCTATGTGACACAGACCGGGACCGCAGCCCGCACCAGTGGCCGCACCACAGCAGCGCAGTGGATGCGTGTTCTT
TTCCATGACTTCATCACGGCCAATGTGAGCGCGGGTACGGGCGGCGTGGATGCAAGCATAGGGTTTGAAACAGCCAGAGAAGAGAACAAGGGGAGTGCCTTCAACGACAGTTTTACTTTT
TGGAGACCGTTTGTGAATGGCGCGGTTTCTA
TGGCGGATCTGATTGCGGTGGGAACTGTCATGTCGAACAACCTATGTGGAGGAAACAACATGCCGTACCGTGCTGGACGGATCGATGCT
CTCTCAGCGGGTTCTACAACGGGCGTCCCAGCACCAGAGACGAGCCTCGAGGAAACGCTCGTCTTTTTCGAGCGCGCAGGATTCGACAAGGTAGACTCCATTGGGCTCACAGCATGTGGC
CACACCATGGGTTCTGTGCATCACGGCGGCTTCCCTGATGTCGTAGACGAATCCTTTGTCACGCCCAACAACACCAATGGTGGCAGCAACTTTGACACCACCCGTGGCGTCTTCGATCCA
AAGGTTGTGGGAGAATACGTCCATTGGACTGGTAACAAAGGCGGTCCCTTGGTCACTTCGTTCAATGAGTCCATGAACTCTGACCTCCGGCTCTACGAGAGCGACAACAACGCTACCATG
CGAGCTCTGCTCGCCCAAGGACCAGCATTCCTAGACACATGTGTGGAACTCATGCGCCGTGCCATCGATACCGTGCCCTCTGGCGTAGAACTTGGGGATGTCATCACAGCCATTCCTGTA
AAGCCCGTCAATGTGACGTACGATTACTCCAAGACAGATGGCAAATTGGTCTTCTCCGGAAAGATCAGGGTATTGACTGTAGCGGGCGCCAAAGCCCCCAACTCACTCACGCTTCACATG
GGCAAGCATGATACCACCACCCATCTCACTGCAGAATCAGAAACAGGGCAATCTGTTTTTGGTCGCGGTGCTGCTGGATACGGAACAACGACATATTTTCCCTTTTCCCTATCCGGACCC
GCACTCCAGAATGCAAGTTCCTTCTCTGTGCGTGGCGAGGGTATTAAGCAAGATTTTCCTGTTAGCAGTCAAGCATTCGTGGTGCCGAGCTTGACGGCTTTGGAGGGTAAGGGATTCAAC
GTTACCGTTGCTGTGGCGGGATCTGCCTCTTGCACAGATGTAAACGTGCGTGTTGCTGCTCCGTTTACGCAACCCTTGACTTTGGCACCCAAAATCAGCAAGAAGGATGTTGGGTTAAAC
GCTGTGGCAGGGACATTGGATGGTTACACTCTCTGTGGTGGTAACATCGTGCTAGACGCCGTACCAACTGGTTTACTTACCGTGGAAGCTTTGCTTGGAGAAAAAGCTGTAGACACACTG
TTGGTAGATGGAGGAAGGGCAGGGTGGTAA

Retrieve as FASTA