Entry information : ClunAPx-CcP02
Entry ID 12026
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ClunAPx-CcP02
Name ClunAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus lunatus (Curvularia lunata)    [TaxId: 5503 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ClunAPx-CcP02
start..stop
S start..stop
SturAPx-CcP02 884 0 1..526 1..527
COsaAPx-CcP02 773 0 1..526 1..525
CheAPx-CcP02_C4 743 0 1..528 1..512
PnoAPx-CcP01 734 0 1..523 1..523
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1297705..1297843 139 N° 2 1297252..1297650 399 N° 3 1296138..1297192 1055  
complement(join(1296138..1297192,1297252..1297650,1297705..1297843))


exon

Literature and cross-references ClunAPx-CcP02
DNA ref. JGI genome:   scaffold_13 (1297843..1296138)
Cluster/Prediction ref. JGI gene:   118951
Protein sequence: ClunAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   531 (512)
PWM (Da):   %s   57837.71 (55840.6)  
PI (pH):   %s   4.59 (4.55) Peptide Signal:   %s   cut: 19 range:19-530
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNNFAIGLALLAPTSQAYVWPSQYDQIDDLLYLQSGYIKAGTLSDQVATCDFGANQPGIQKAAEWVRTAFHDTVTHDASTKTGGLDASIQYELDRPENLGAALNNTLADISSSFDIRTSAADLIALSLVMSVARCGDMRVPLRLGRKDATKAGIKGVPEAHTDLGTTRKRFEAASLSEADMITLIACGHSIGGVHSVDHPEIVSGPVSPENKASFDTTLGALDNKVVVEYLNNSTANPLVRNSNDTLNSDKRIFASDDNKTMRKLADPGYFKTQCEDVFGRMLDLVPGDVMLTEPLQPADVRPYIETYGLNANGGVDFSGRIRVRITPSTGRDPDSLMASIIPMTRNGIAMQEIDALRATFRLGQSMGYLDEAFQWFEFSQTIDASETFDSFRIRINDKTYDNAGTGGYPVNSDVFLQEKQTCIAYDTATNQGNLTVTAAVSKALLQSKPTPQIRFVRRENVQGYFIPRLEQVVTPMQYAGKETAQYIYYTAAVAVNADSFSTTFDLEVGDSKLEYISTAGFDSCETPR

Retrieve as FASTA  
Remarks complete sequence from genomics (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACAACTTTGCAATTGGTCTTGCGCTACTTGCGCCCACTTCACAAGCCTATGTCTGGCCCAGCCAGTACGACCAGATCGACGACCTTTTGTATCTACAATCTGGCTACATCAAA
GCTGGCACTCTCTCTGACC
GTGCGCATTTCCCTTCCCAACTCGTAACTTCTAAGAAGACTTACACAGATACAGAAGTCGCAACATGCGACTTTGGCGCCAACCAGCCCGGCATACAAAAG
GCAGCGGAGTGGGTACGGACCGCATTTCACGACACTGTTACGCATGATGCTTCTACCAAGACTGGAGGACTTGATGCTTCGATACAATACGAGCTCGACCGACCAGAGAACCTAGGTGCT
GCCCTGAACAACACCTTAGCGGACATCTCTTCTTCCTTCGATATTCGTACCTCAGCCGCAGACCTTATCGCGTTGTCTCTGGTTATGTCAGTAGCTCGCTGCGGTGATATGCGCGTGCCG
TTAAGGCTGGGTCGGAAGGATGCCACAAAAGCCGGTATCAAAGGAGTGCCTGAGGCCCATACAGATCTAGGTACCACTCGCAAGAGATTTGAAGCTGCTAGCCTCAGCGAAG
GTAATCTT
GACTTTTTTTCAAGATTGGTTGATTGGTCGAAAGCTGACTTGTGTTTACAGCTGACATGATTACCTTGATTGCATGTGGTCACAGTATTGGTGGCGTTCACTCGGTCGACCATCCTGAGA
TTGTGTCTGGCCCAGTCAGCCCGGAAAACAAAGCCAGCTTTGACACCACTCTGGGCGCTCTAGATAATAAGGTGGTAGTAGAGTATCTGAACAATTCCACAGCAAATCCCCTGGTTCGCA
ACTCAAATGATACACTGAACTCTGATAAACGCATCTTCGCTTCGGACGACAACAAGACCATGAGAAAGCTCGCAGATCCCGGCTACTTCAAGACGCAGTGTGAAGATGTATTTGGACGCA
TGCTGGATCTTGTTCCTGGAGATGTTATGCTCACTGAGCCTTTGCAGCCAGCAGATGTCAGGCCATACATCGAGACATATGGACTGAACGCCAATGGGGGGGTCGACTTCTCAGGCCGTA
TCCGTGTTCGTATCACACCCAGTACAGGTCGCGATCCCGACTCTCTCATGGCATCTATCATTCCCATGACTCGCAATGGAATTGCAATGCAGGAGATTGATGCTCTACGCGCCACATTCC
GCCTTGGGCAATCAATGGGCTACTTGGATGAAGCGTTCCAATGGTTCGAATTCAGCCAGACGATTGATGCCAGCGAGACATTCGACTCGTTCAGAATTCGTATCAACGACAAAACTTACG
ACAACGCTGGAACGGGTGGTTATCCTGTTAATTCAGATGTGTTCCTCCAGGAGAAGCAGACGTGCATAGCATATGACACAGCTACGAACCAAGGTAACCTTACTGTGACTGCTGCTGTTT
CCAAGGCTCTCCTTCAGAGTAAGCCCACACCACAAATTCGCTTTGTGAGAAGGGAAAACGTCCAAGGATACTTCATTCCTCGCTTGGAACAAGTCGTTACCCCTATGCAGTATGCAGGCA
AAGAGACCGCTCAATACATATACTATACAGCAGCAGTGGCTGTAAATGCGGACAGCTTTTCTACAACCTTCGATCTTGAGGTTGGTGATTCTAAGCTAGAGTACATTAGTACAGCAGGGT
TTGACAGCTGTGAGACACCCCGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACAACTTTGCAATTGGTCTTGCGCTACTTGCGCCCACTTCACAAGCCTATGTCTGGCCCAGCCAGTACGACCAGATCGACGACCTTTTGTATCTACAATCTGGCTACATCAAA
GCTGGCACTCTCTCTGACC
AAGTCGCAACATGCGACTTTGGCGCCAACCAGCCCGGCATACAAAAGGCAGCGGAGTGGGTACGGACCGCATTTCACGACACTGTTACGCATGATGCTTCT
ACCAAGACTGGAGGACTTGATGCTTCGATACAATACGAGCTCGACCGACCAGAGAACCTAGGTGCTGCCCTGAACAACACCTTAGCGGACATCTCTTCTTCCTTCGATATTCGTACCTCA
GCCGCAGACCTTATCGCGTTGTCTCTGGTTATGTCAGTAGCTCGCTGCGGTGATATGCGCGTGCCGTTAAGGCTGGGTCGGAAGGATGCCACAAAAGCCGGTATCAAAGGAGTGCCTGAG
GCCCATACAGATCTAGGTACCACTCGCAAGAGATTTGAAGCTGCTAGCCTCAGCGAAG
CTGACATGATTACCTTGATTGCATGTGGTCACAGTATTGGTGGCGTTCACTCGGTCGACCAT
CCTGAGATTGTGTCTGGCCCAGTCAGCCCGGAAAACAAAGCCAGCTTTGACACCACTCTGGGCGCTCTAGATAATAAGGTGGTAGTAGAGTATCTGAACAATTCCACAGCAAATCCCCTG
GTTCGCAACTCAAATGATACACTGAACTCTGATAAACGCATCTTCGCTTCGGACGACAACAAGACCATGAGAAAGCTCGCAGATCCCGGCTACTTCAAGACGCAGTGTGAAGATGTATTT
GGACGCATGCTGGATCTTGTTCCTGGAGATGTTATGCTCACTGAGCCTTTGCAGCCAGCAGATGTCAGGCCATACATCGAGACATATGGACTGAACGCCAATGGGGGGGTCGACTTCTCA
GGCCGTATCCGTGTTCGTATCACACCCAGTACAGGTCGCGATCCCGACTCTCTCATGGCATCTATCATTCCCATGACTCGCAATGGAATTGCAATGCAGGAGATTGATGCTCTACGCGCC
ACATTCCGCCTTGGGCAATCAATGGGCTACTTGGATGAAGCGTTCCAATGGTTCGAATTCAGCCAGACGATTGATGCCAGCGAGACATTCGACTCGTTCAGAATTCGTATCAACGACAAA
ACTTACGACAACGCTGGAACGGGTGGTTATCCTGTTAATTCAGATGTGTTCCTCCAGGAGAAGCAGACGTGCATAGCATATGACACAGCTACGAACCAAGGTAACCTTACTGTGACTGCT
GCTGTTTCCAAGGCTCTCCTTCAGAGTAAGCCCACACCACAAATTCGCTTTGTGAGAAGGGAAAACGTCCAAGGATACTTCATTCCTCGCTTGGAACAAGTCGTTACCCCTATGCAGTAT
GCAGGCAAAGAGACCGCTCAATACATATACTATACAGCAGCAGTGGCTGTAAATGCGGACAGCTTTTCTACAACCTTCGATCTTGAGGTTGGTGATTCTAAGCTAGAGTACATTAGTACA
GCAGGGTTTGACAGCTGTGAGACACCCCGGTAG

Retrieve as FASTA