Entry information : MdurCcP01
Entry ID 12028
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: MdurCcP01
Name MdurCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Myriangiaceae Myriangium
Organism Myriangium duriaei    [TaxId: 147570 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MdurCcP01
start..stop
S start..stop
HpulCcP02 541 0 17..352 28..366
XhevCcP01 539 0 1..352 1..368
ApulCcP01 534 0 1..353 1..359
BdotCcP01 531 0 22..352 38..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 370284..370321 38 N° 2 370361..371156 796 N° 3 371213..371440 228  
join(370284..370321,370361..371156,371213..371440)


exon

Literature and cross-references MdurCcP01
DNA ref. JGI genome:   scaffold_2 (370284..371440)
Cluster/Prediction ref. JGI gene:   326289
Protein sequence: MdurCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354
PWM (Da):   %s   39105.27  
PI (pH):   %s   8.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTARSIPRVFRRWVAAARPAFRQQGRRGYASSTGGSGGNGALFGGLAAAAIAGGAGFYLYNNSTSSDSKTTVFKPSKEDYQKVYDAVAKRLVEHDDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFAPEGDHGANAGLKAARDFLEPVKEQFPWITWSDLWTLSGVCAIQEMQGPAIPWRPGRADRDVSFCTPDGRLPDASKAQDHLRAIFYRMGFDDREIVALSGAHALGRCHTDRSGFEGPWTFSPTTLTNDYYKLLLEEKWSYRKNGPKQFQDVSSKSLMMLPSDMALIKDKSFRPHVERYAKDNEAFFKEFSDVVVRLFELGVPFTSGEDARMTFKVSE*

Retrieve as FASTA  
Remarks complete sequence from genomics (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCACCGCCAGATCCATTCCCAGAGTCTTCCGGTCTGTCCCGACCAAGAGCTCGCTGATAGCGGGTAACAGCCGCTGGGTGGCTGCCGCTCGTCCTGCTTTCCGTCAGCAAGGC
CGCCGTGGCTACGCCTCTTCTACCGGAGGCAGCGGTGGTAATGGGGCTTTGTTCGGTGGTCTCGCCGCTGCCGCTATCGCAGGAGGGGCGGGTTTCTACCTCTACAACAACTCGACGTCG
AGCGACTCCAAGACCACCGTCTTCAAGCCTTCCAAAGAGGACTACCAGAAAGTCTACGATGCTGTTGCCAAGCGACTAGTCGAGCACGATGACTATGACGATGGAAGCTACGGACCCGTA
CTGGTCAGACTCGCGTGGCACGCTTCGGGAACATACGACAAGGAGACGGGCACCGGTGGCAGCAACGGAGCGACCATGAGATTCGCACCCGAAGGAGACCACGGCGCCAACGCCGGTCTC
AAGGCCGCTAGGGATTTCTTGGAGCCGGTCAAGGAGCAATTCCCTTGGATCACTTGGTCCGACTTGTGGACGCTGTCCGGCGTTTGCGCCATTCAGGAAATGCAGGGCCCTGCCATTCCC
TGGAGACCTGGCCGCGCAGACCGTGACGTGTCCTTCTGCACACCTGACGGCCGTCTTCCGGACGCCTCCAAGGCCCAAGACCATCTGAGGGCCATCTTCTACCGTATGGGCTTCGACGAC
CGCGAGATTGTTGCTCTTTCAGGTGCTCACGCTCTTGGGCGCTGCCACACCGACAGGTCCGGGTTCGAAGGTCCTTGGACTTTCTCTCCCACGACCCTCACCAACGACTACTACAAGCTG
CTTCTCGAGGAGAAGTGGTCTTACAGGAAATGG
GTAAGTCCTGCTTTAGCCAAGAAATGTTTCATGGCCTGTGCTGACGTGCATGCTAGAACGGCCCCAAGCAATTCCAGGACGTCAGCT
CCAAGAGCTTGATGATGCTGCCGAGCGACATGGCGTTGATTAAAGACAAGAGCTTCAGGCCGCACGTGGAGCGCTATGCTAAGGATAATGAGGCTTTCTTCAAGGAGTTTTCGGACGTGG
TCGTCAGGCTGTTTGAGCTTGGTGTGCCCTTCACCAGCGGCGAGGATGCGAGGATGACCTTCAAGGTCTCGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCACCGCCAGATCCATTCCCAGAGTCTTCCGCCGCTGGGTGGCTGCCGCTCGTCCTGCTTTCCGTCAGCAAGGCCGCCGTGGCTACGCCTCTTCTACCGGAGGCAGCGGTGGT
AATGGGGCTTTGTTCGGTGGTCTCGCCGCTGCCGCTATCGCAGGAGGGGCGGGTTTCTACCTCTACAACAACTCGACGTCGAGCGACTCCAAGACCACCGTCTTCAAGCCTTCCAAAGAG
GACTACCAGAAAGTCTACGATGCTGTTGCCAAGCGACTAGTCGAGCACGATGACTATGACGATGGAAGCTACGGACCCGTACTGGTCAGACTCGCGTGGCACGCTTCGGGAACATACGAC
AAGGAGACGGGCACCGGTGGCAGCAACGGAGCGACCATGAGATTCGCACCCGAAGGAGACCACGGCGCCAACGCCGGTCTCAAGGCCGCTAGGGATTTCTTGGAGCCGGTCAAGGAGCAA
TTCCCTTGGATCACTTGGTCCGACTTGTGGACGCTGTCCGGCGTTTGCGCCATTCAGGAAATGCAGGGCCCTGCCATTCCCTGGAGACCTGGCCGCGCAGACCGTGACGTGTCCTTCTGC
ACACCTGACGGCCGTCTTCCGGACGCCTCCAAGGCCCAAGACCATCTGAGGGCCATCTTCTACCGTATGGGCTTCGACGACCGCGAGATTGTTGCTCTTTCAGGTGCTCACGCTCTTGGG
CGCTGCCACACCGACAGGTCCGGGTTCGAAGGTCCTTGGACTTTCTCTCCCACGACCCTCACCAACGACTACTACAAGCTGCTTCTCGAGGAGAAGTGGTCTTACAGGAAATGG
AACGGC
CCCAAGCAATTCCAGGACGTCAGCTCCAAGAGCTTGATGATGCTGCCGAGCGACATGGCGTTGATTAAAGACAAGAGCTTCAGGCCGCACGTGGAGCGCTATGCTAAGGATAATGAGGCT
TTCTTCAAGGAGTTTTCGGACGTGGTCGTCAGGCTGTTTGAGCTTGGTGTGCCCTTCACCAGCGGCGAGGATGCGAGGATGACCTTCAAGGTCTCGGAGTAA

Retrieve as FASTA