Entry information : MdurAPx-CcP01
Entry ID 12030
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: MdurAPx-CcP01
Name MdurAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Myriangiaceae Myriangium
Organism Myriangium duriaei    [TaxId: 147570 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MdurAPx-CcP01
start..stop
S start..stop
MdurAPx-CcP02 651 0 1..534 1..544
BdotAPx-CcP01 422 3e-143 2..508 5..513
CgloAPx-CcP01_ST23 417 3e-141 1..510 1..513
CfioAPx-CcP01_PJ7 407 2e-137 1..531 1..535
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2070948..2071087 140 N° 2 2071146..2072347 1202 N° 3 2072384..2072646 263  
join(2070948..2071087,2071146..2072347,2072384..2072646)


exon

Literature and cross-references MdurAPx-CcP01
DNA ref. JGI genome:   scaffold_4 (2070948..2072646)
Cluster/Prediction ref. JGI gene:   223802
Protein sequence: MdurAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   535 (517)
PWM (Da):   %s   58838.37 (56847.2)  
PI (pH):   %s   9.88 (9.96) Peptide Signal:   %s   cut: 18 range:18-534
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLACIIFIALWHPGIATYVWPARFDYLEDLYAMYIGSIKSGFTDRNHSGRGLRPIENAAERVRTAFHDSITYSKKTRRGGLDASIMFELDRDENKGAAFNNTLNAVRDLVTAKSSVADLLALSLAASSVTCEGPQIPLRFGRIDAQAAGPAGVPLPTDSVEVATRAFVNAGFTQEEMITLVACGHTLGRVHSVDFPNLVEGAPSQENNADFDTTRLKFDNLVVTEFLSNNTKNPLVIAKDETFHSDKRIFSIGNRAVMQKLNDPTTYQKQCATLLERMINTVPGNVKLSAPVAPIDMKPYITTLQLQDDGNILFEGRLRFRSASFAGQDPKDLAVSLRLTTFDRSKTNLVVQAAPATFSSSANEVFAWFEFSTVVAGRGGIRSFEVQTKSKSQAKARVVTYNNAGTGGYPVNTNIMYQLTNSCLDTSASPGKLTIVAAMRRSRFGRRGARAGPQLHLSRLVPRPGVMIPRLQADVLRMQKTQKQIGQYDIYRIETQLESPSWSSTFALGTMRRPARDLLFLKELSAKKCEEL

Retrieve as FASTA  
Remarks complete sequence from genomics (2 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACTTGCCTGCATAATCTTCATCGCCTTATGGCATCCTGGAATCGCCACTTATGTCTGGCCAGCAAGATTCGATTATCTTGAAGACCTGTACGCCATGTATATTGGGTCTATCAAA
TCTGGATTCACCGATCGCAA
GTATCTCTCTCCTACTGACTATGCGCCATTCTGACTCGGCCGCAGAGGGGGCACCCAGTCACAGCGGCCGGGGCCTGCGTCCAATCGAAAATGCTGCGGA
GAGAGTGCGCACTGCCTTCCACGATTCCATCACCTATAGCAAGAAGACCAGACGTGGTGGGTTGGACGCTTCGATCATGTTCGAGCTTGATCGCGATGAGAACAAAGGAGCAGCTTTCAA
CAACACTCTGAATGCCGTACGCGACCTCGTCACGGCGAAATCTAGCGTTGCAGATCTGCTCGCACTGAGCCTTGCAGCATCCAGCGTCACGTGCGAGGGACCACAGATCCCTTTGAGATT
TGGCAGGATTGACGCTCAAGCTGCTGGTCCTGCTGGTGTGCCACTGCCTACAGACAGTGTAGAAGTGGCAACTCGGGCATTTGTCAATGCTGGTTTTACTCAAGAGGAGATGATCACACT
AGTAGCCTGTGGACACACTCTGGGTCGTGTACACAGTGTTGACTTCCCCAACCTTGTGGAAGGTGCACCTTCCCAAGAGAACAACGCTGATTTCGATACAACGCGTTTGAAGTTCGACAA
TCTCGTTGTGACGGAGTTTTTGTCTAACAATACCAAGAATCCACTAGTCATAGCCAAAGACGAGACCTTTCATTCAGATAAGCGTATCTTCTCGATCGGCAATCGTGCCGTGATGCAGAA
GCTCAACGATCCCACCACTTATCAGAAGCAGTGCGCTACTTTGCTTGAACGCATGATCAACACGGTGCCTGGAAACGTCAAACTCAGCGCTCCTGTGGCTCCAATCGACATGAAGCCTTA
CATAACAACCCTGCAACTTCAAGATGACGGCAATATCCTTTTCGAGGGTCGACTCCGATTTCGCAGTGCGAGCTTTGCTGGTCAAGATCCAAAAGATCTTGCAGTATCGCTTCGTCTTAC
CACCTTTGACAGGTCCAAAACTAATCTGGTGGTCCAAGCAGCTCCAGCAACTTTTTCAAGTAGTGCAAACGAAGTCTTCGCTTGGTTCGAGTTTAGCACAGTAGTTGCTGGTCGTGGCGG
CATTAGGTCATTCGAAGTTCAGACCAAGAGCAAGAGTCAAGCAAAAGCGCGAGTAGTGACGTACAACAACGCAGGCACGGGCGGCTACCCGGTAAACACGAACATCATGTATCAGCTCAC
CAACTCGTGCTTAGATACCTCGGCTAGTCCCGGCAAGCTGACCATTGTTGCTGCAATGCGTAGATCTCGATTCGGACCTC
GTTGCTCCCATCGTGGAGGTGGTGGAGGCTGCGGAGGACG
TGGGGCACGTGCTGGACCGCAGCTTCATTTGTCTCGCCTTGTCCCTCGGCCCGGAGTCATGATTCCGCGACTGCAGGCTGACGTCTTGAGGATGCAGAAGACACAAAAGCAGATTGGACA
GTACGATATCTATCGAATTGAGACCCAGCTGGAATCGCCTAGTTGGTCTAGCACATTCGCTTTAGGCACGATGCGAAGGCCGGCTAGAGACCTGCTCTTCTTGAAAGAGTTGTCAGCCAA
AAAGTGTGAAGAGTTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACTTGCCTGCATAATCTTCATCGCCTTATGGCATCCTGGAATCGCCACTTATGTCTGGCCAGCAAGATTCGATTATCTTGAAGACCTGTACGCCATGTATATTGGGTCTATCAAA
TCTGGATTCACCGATCGCAA
TCACAGCGGCCGGGGCCTGCGTCCAATCGAAAATGCTGCGGAGAGAGTGCGCACTGCCTTCCACGATTCCATCACCTATAGCAAGAAGACCAGACGTGGT
GGGTTGGACGCTTCGATCATGTTCGAGCTTGATCGCGATGAGAACAAAGGAGCAGCTTTCAACAACACTCTGAATGCCGTACGCGACCTCGTCACGGCGAAATCTAGCGTTGCAGATCTG
CTCGCACTGAGCCTTGCAGCATCCAGCGTCACGTGCGAGGGACCACAGATCCCTTTGAGATTTGGCAGGATTGACGCTCAAGCTGCTGGTCCTGCTGGTGTGCCACTGCCTACAGACAGT
GTAGAAGTGGCAACTCGGGCATTTGTCAATGCTGGTTTTACTCAAGAGGAGATGATCACACTAGTAGCCTGTGGACACACTCTGGGTCGTGTACACAGTGTTGACTTCCCCAACCTTGTG
GAAGGTGCACCTTCCCAAGAGAACAACGCTGATTTCGATACAACGCGTTTGAAGTTCGACAATCTCGTTGTGACGGAGTTTTTGTCTAACAATACCAAGAATCCACTAGTCATAGCCAAA
GACGAGACCTTTCATTCAGATAAGCGTATCTTCTCGATCGGCAATCGTGCCGTGATGCAGAAGCTCAACGATCCCACCACTTATCAGAAGCAGTGCGCTACTTTGCTTGAACGCATGATC
AACACGGTGCCTGGAAACGTCAAACTCAGCGCTCCTGTGGCTCCAATCGACATGAAGCCTTACATAACAACCCTGCAACTTCAAGATGACGGCAATATCCTTTTCGAGGGTCGACTCCGA
TTTCGCAGTGCGAGCTTTGCTGGTCAAGATCCAAAAGATCTTGCAGTATCGCTTCGTCTTACCACCTTTGACAGGTCCAAAACTAATCTGGTGGTCCAAGCAGCTCCAGCAACTTTTTCA
AGTAGTGCAAACGAAGTCTTCGCTTGGTTCGAGTTTAGCACAGTAGTTGCTGGTCGTGGCGGCATTAGGTCATTCGAAGTTCAGACCAAGAGCAAGAGTCAAGCAAAAGCGCGAGTAGTG
ACGTACAACAACGCAGGCACGGGCGGCTACCCGGTAAACACGAACATCATGTATCAGCTCACCAACTCGTGCTTAGATACCTCGGCTAGTCCCGGCAAGCTGACCATTGTTGCTGCAATG
CGTAGATCTCGATTCGGACCTC
GACGTGGGGCACGTGCTGGACCGCAGCTTCATTTGTCTCGCCTTGTCCCTCGGCCCGGAGTCATGATTCCGCGACTGCAGGCTGACGTCTTGAGGATG
CAGAAGACACAAAAGCAGATTGGACAGTACGATATCTATCGAATTGAGACCCAGCTGGAATCGCCTAGTTGGTCTAGCACATTCGCTTTAGGCACGATGCGAAGGCCGGCTAGAGACCTG
CTCTTCTTGAAAGAGTTGTCAGCCAAAAAGTGTGAAGAGTTGTGA

Retrieve as FASTA