Entry information : MdurAPx-CcP02
Entry ID 12031
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: MdurAPx-CcP02
Name MdurAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Myriangiaceae Myriangium
Organism Myriangium duriaei    [TaxId: 147570 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MdurAPx-CcP02
start..stop
S start..stop
MdurAPx-CcP01 642 0 1..544 1..534
BdotAPx-CcP01 416 7e-141 4..523 6..518
CgloAPx-CcP01_ST23 416 2e-140 1..534 1..530
CfioAPx-CcP01_PJ7 399 3e-134 1..541 1..535
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 302206..302369 164 N° 2 300699..302169 1471  
complement(join(300699..302169,302206..302369))


exon

Literature and cross-references MdurAPx-CcP02
DNA ref. JGI genome:   scaffold_6 (302369..300699)
Cluster/Prediction ref. JGI gene:   278521
Protein sequence: MdurAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   545 (526)
PWM (Da):   %s   60085.76 (58056.7)  
PI (pH):   %s   8.07 (8.05) Peptide Signal:   %s   cut: 19 range:19-544
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKHIHILLFAASAHSASTYVWPGKYDYLEDLYTLYTGSIQSRFTDRTSSYSEGNTRTGKGLVPIANAPERVRTAFHDVITFDKNTGQGGLDASIMFELDRPENKGAAFNNTLNAIKDMVTTKSSVADLLAMTLAASCVTCKGPQIPLRFGRVDAKAAGPATGATSGVPSPLDDVEVSTQKFASAGFSQDDMITLLACGHTLGRVHSVNLPGAFDSPPSNDLNADFDTTRVTFDNLVVSEFLSGNSKNPLVVAKNDSFNSDKRIFSINDRAVVQKLNDPAEFKQQCVAVLERMINTVPSNVRLSNPINLIDVKPYITNLELQKDGNILFEGRVRFRRSALSDRNPDDLDVALRIVDHTGSRTHTLVPATREQLQTFDTQEFVWYDFSKAVDGQVGLKGFDIQVQDKNNPNVQSIVISNGGAGTFPVTTDILYQLSNSCLDTSKDPGKLIVVTAVRRRSNGRCRRVPQLRLSKKIPREGVMIPRLHVEHTKMTKTDKQIGQYDLYRAELDLASPSWSSTFDVRIPFGPKRELLFLRELANKQCEEL

Retrieve as FASTA  
Remarks incorrect prediction from genomics (1 intron). 5'end added tanks to softberry.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCACATACACATCCTGCTCTTTGCCGCGTCGGCACATTCGGCAAGCACTTATGTATGGCCGGGAAAGTATGACTATCTCGAGGACTTATATACCCTCTACACTGGCTCTATACAG
TCGCGATTCACTGATCGTACGTCTTCATATAGTGAGGGCAACAC
GTGTGTAAACTGACATGCATAAGAGGGAGCCCCTAGTCGTACCGGCAAAGGACTGGTCCCCATTGCTAACGCCCCT
GAAAGAGTGCGAACCGCCTTTCATGACGTGATCACCTTTGACAAGAACACCGGCCAGGGTGGCTTGGATGCCTCGATTATGTTCGAACTTGATCGTCCTGAGAACAAAGGAGCAGCGTTC
AACAATACTCTGAATGCTATAAAAGACATGGTAACCACCAAATCCAGTGTGGCTGATCTACTGGCTATGACTTTAGCAGCATCTTGTGTTACTTGCAAAGGACCACAAATTCCGCTAAGA
TTTGGCAGAGTTGATGCCAAAGCAGCGGGCCCTGCCACAGGTGCTACCAGTGGCGTGCCTTCGCCCTTGGATGACGTTGAGGTAAGCACACAAAAATTCGCCAGTGCTGGCTTCTCACAG
GACGACATGATCACTTTGCTGGCTTGCGGACACACTCTTGGTCGCGTGCATAGTGTGAACCTTCCAGGAGCGTTCGACTCACCACCTTCTAACGACTTGAATGCCGACTTCGACACGACT
CGGGTGACATTTGATAATCTCGTTGTGTCGGAATTCCTGTCTGGCAATAGCAAAAATCCCCTTGTTGTGGCCAAGAATGATTCATTTAACTCAGACAAGCGCATCTTTTCCATCAACGAC
CGTGCTGTGGTGCAAAAACTCAATGATCCAGCCGAATTCAAGCAACAGTGCGTGGCGGTACTGGAACGCATGATAAATACAGTGCCGTCAAATGTGAGACTCAGCAACCCAATCAACCTC
ATCGACGTCAAGCCATACATCACCAACCTTGAGCTCCAGAAGGATGGTAATATCCTGTTCGAAGGCCGGGTCCGTTTCCGTAGGTCTGCGCTGAGTGATCGGAATCCCGACGACCTCGAC
GTAGCTCTACGGATCGTTGATCATACCGGATCAAGAACACACACGCTAGTCCCTGCAACTCGCGAGCAACTCCAAACTTTCGACACTCAGGAGTTTGTGTGGTACGATTTCAGCAAGGCG
GTCGACGGTCAAGTCGGCCTCAAGGGATTCGACATCCAGGTTCAAGACAAGAACAATCCGAACGTTCAGTCCATTGTCATCAGCAACGGCGGCGCAGGCACCTTCCCTGTGACGACCGAT
ATCCTATACCAACTCTCCAATTCCTGTCTCGACACATCCAAAGACCCTGGCAAACTGATCGTCGTGACGGCGGTGCGAAGGAGGTCTAATGGACGATGTCGGCGAGTGCCTCAGCTTCGC
TTGTCTAAGAAGATACCTCGGGAAGGAGTTATGATTCCTCGCCTGCACGTGGAGCATACTAAGATGACCAAGACTGACAAGCAGATCGGTCAGTATGACCTTTACCGGGCCGAATTGGAC
TTGGCCTCGCCCAGCTGGTCGAGCACGTTTGATGTCAGGATTCCGTTTGGGCCGAAGAGGGAGCTTCTTTTCTTAAGGGAGCTTGCAAATAAGCAGTGTGAGGAGCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCACATACACATCCTGCTCTTTGCCGCGTCGGCACATTCGGCAAGCACTTATGTATGGCCGGGAAAGTATGACTATCTCGAGGACTTATATACCCTCTACACTGGCTCTATACAG
TCGCGATTCACTGATCGTACGTCTTCATATAGTGAGGGCAACAC
TCGTACCGGCAAAGGACTGGTCCCCATTGCTAACGCCCCTGAAAGAGTGCGAACCGCCTTTCATGACGTGATCACC
TTTGACAAGAACACCGGCCAGGGTGGCTTGGATGCCTCGATTATGTTCGAACTTGATCGTCCTGAGAACAAAGGAGCAGCGTTCAACAATACTCTGAATGCTATAAAAGACATGGTAACC
ACCAAATCCAGTGTGGCTGATCTACTGGCTATGACTTTAGCAGCATCTTGTGTTACTTGCAAAGGACCACAAATTCCGCTAAGATTTGGCAGAGTTGATGCCAAAGCAGCGGGCCCTGCC
ACAGGTGCTACCAGTGGCGTGCCTTCGCCCTTGGATGACGTTGAGGTAAGCACACAAAAATTCGCCAGTGCTGGCTTCTCACAGGACGACATGATCACTTTGCTGGCTTGCGGACACACT
CTTGGTCGCGTGCATAGTGTGAACCTTCCAGGAGCGTTCGACTCACCACCTTCTAACGACTTGAATGCCGACTTCGACACGACTCGGGTGACATTTGATAATCTCGTTGTGTCGGAATTC
CTGTCTGGCAATAGCAAAAATCCCCTTGTTGTGGCCAAGAATGATTCATTTAACTCAGACAAGCGCATCTTTTCCATCAACGACCGTGCTGTGGTGCAAAAACTCAATGATCCAGCCGAA
TTCAAGCAACAGTGCGTGGCGGTACTGGAACGCATGATAAATACAGTGCCGTCAAATGTGAGACTCAGCAACCCAATCAACCTCATCGACGTCAAGCCATACATCACCAACCTTGAGCTC
CAGAAGGATGGTAATATCCTGTTCGAAGGCCGGGTCCGTTTCCGTAGGTCTGCGCTGAGTGATCGGAATCCCGACGACCTCGACGTAGCTCTACGGATCGTTGATCATACCGGATCAAGA
ACACACACGCTAGTCCCTGCAACTCGCGAGCAACTCCAAACTTTCGACACTCAGGAGTTTGTGTGGTACGATTTCAGCAAGGCGGTCGACGGTCAAGTCGGCCTCAAGGGATTCGACATC
CAGGTTCAAGACAAGAACAATCCGAACGTTCAGTCCATTGTCATCAGCAACGGCGGCGCAGGCACCTTCCCTGTGACGACCGATATCCTATACCAACTCTCCAATTCCTGTCTCGACACA
TCCAAAGACCCTGGCAAACTGATCGTCGTGACGGCGGTGCGAAGGAGGTCTAATGGACGATGTCGGCGAGTGCCTCAGCTTCGCTTGTCTAAGAAGATACCTCGGGAAGGAGTTATGATT
CCTCGCCTGCACGTGGAGCATACTAAGATGACCAAGACTGACAAGCAGATCGGTCAGTATGACCTTTACCGGGCCGAATTGGACTTGGCCTCGCCCAGCTGGTCGAGCACGTTTGATGTC
AGGATTCCGTTTGGGCCGAAGAGGGAGCTTCTTTTCTTAAGGGAGCTTGCAAATAAGCAGTGTGAGGAGCTGTAA

Retrieve as FASTA