Entry information : LuAPx137 (Lus10025680|PACid:23145012)
Entry ID 12040
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-11 (Qiang Li)
Peroxidase information: LuAPx137 (Lus10025680|PACid:23145012)
Name (synonym) LuAPx137 (Lus10025680|PACid:23145012)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuAPx137
start..stop
S start..stop
LuAPx97 811 0 1..434 1..433
MeAPx05 669 0 1..434 1..428
PtAPx07 647 0 1..434 1..424
PtAPx08 641 0 70..434 45..409
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 956152..956409 258 N° 2 955959..956066 108 N° 3 955759..955879 121 N° 4 955494..955594 101
N° 5 955279..955366 88 N° 6 954939..955006 68 N° 7 954764..954850 87 N° 8 954288..954362 75
N° 9 954115..954192 78 N° 10 953930..954034 105 N° 11 953785..953847 63 N° 12 952914..953066 153
complement(join(952914..953066,953785..953847,953930..954034,954115..954192,9542 88..954362,954764..954850,954939..955006,955279..955366,955494..955594,955759..9 55879,955959..956066,956152..956409))


exon

Literature and cross-references LuAPx137 (Lus10025680|PACid:23145012)
DNA ref. Phytozome 11:   scaffold145 (956409..952914)
Protein sequence: LuAPx137 (Lus10025680|PACid:23145012)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   435
PWM (Da):   %s   47345.01 Transmb domain:   %s   o414-433i
PI (pH):   %s   8.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHCPSHLQLSKSPQHHSPPPPFQMASSTLSTAAAATSSRLLLPSSSTTARAHIRQHLSTSSTHGFSPLKCIRSSPLPPFRAFSNQRRPLSAVAAASDPAQLKSAREDIKEILKSKFCHPILVRLGWHDAGTYNKDIEEFPMRGGANGSLRFDIELKHGANAGLVNALSLLQPIKEKYSGVTYADLFQLASATAIEAGGPKIPMKYGRVDVSAPEECPEEGRLPDAGPPSPADHLRKVFYRMGLNDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTAEWLKFDNSYFKDIKAQIDEDLLVLPTDAAIFEDPSFKVYAEKYAEDQDAFFKDYAEAHAKLSNLGSKFDPPEGIVLDGVQGEKFVAANYSYGKREFSDSMKQKMRAEYEAIGGSPSKALSSNYFLNIIIVISVLAVLTYLFGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTGTCCATCTCACCTGCAACTATCCAAATCGCCGCAGCATCATTCGCCTCCACCACCATTTCAAATGGCTTCTTCAACTCTCAGCACGGCCGCCGCCGCCACGTCCTCTCGC
CTCCTCCTCCCTTCCTCCTCCACCACCGCTCGTGCTCACATCCGCCAACACCTCTCAACTTCTTCCACTCACGGCTTCTCTCCTCTCAAATGCATTCGATCCTCTCCTCTCCCTCCGTTT
CGCGCCTTCTCCAACCAG
GTCCTCCTCTTCCTTCATTTTCTTTGTATTCAGCTTCCGTTTGCTTATTGTACGTCGCTTAATGCTGTTCTTATGGAATTTGCAGAGGAGGCCGTTGAGCGC
GGTCGCTGCTGCGTCCGATCCTGCTCAGTTGAAGAGCGCTAGGGAGGATATCAAGGAGATTCTCAAGTCCAAGTTCTGTCATCCGATTCTG
GTGCTTGTTGCCTTCTGCTTGTATTTTAT
TGACTTCCGTTTGTTTTTCTTCTTGTATTTGAACTGTTGTTCTTCTATAGGTTCGATTGGGGTGGCATGATGCCGGGACGTACAACAAGGACATCGAGGAGTTCCCGATGAGAGGTGGAG
CTAACGGAAGTCTTCGATTCGATATTGAGCTCAAGCACGGTGCAAATGCTG
GTATAAACTTCTTCCTGACTATGTTGCAGTTGTAGTTTGCCTTTTGAATTTCTGAGCTGGTGAAGAGTA
GAGGAGAATCACGCAAGTGGTGACGGTTTCTTGCTGTTTGGATAGAATGTATCCTGTCATCTGCTGATGGATTGGATTGTGTGATCTCATTTCAGGGCTTGTCAATGCATTGAGTCTGCT
TCAACCTATCAAAGAAAAGTATTCTGGTGTTACCTATGCTGATTTGTTCCAGTTAGCTAGTGCTACTGCCATTGAG
GTAGGACATTTGCTCTTAACGTGCTGATTATTGGAGCTCAAGTT
GTTCTCAAGCAAGAAGAAAGAGTTGAATGCTCAATACTAAACTGTAGTTGTTGATATTACATTATGTGGATTGATTATCTTAGGAAGCTGGCGGGCCTAAAATCCCAATGAAATATGGAA
GGGTAGATGTCTCTGCTCCAGAGGAATGCCCAGAGGAGGGAAGACTTCCTG
GTGAGTGTGCTAAACTTGCTGCTATTGTGCCTGAAAAAATTCGAGTTAAATGTACTGCGATGGCTTTTT
AGAAGGTGAACATTTTAGTTTTGTGAGATTCTTCATTCCTGGGGATAAAAACGAATATGAATACTGGGAATGAGATCTGGGATCACCAGCTGACACGATTTTGTAACATGTTAGAGTGAC
TTAAGATTTTATCATTGTCTCTGGAAAAGGAGTTTGGTTTTTGCTTGAATCTTTTATAATGAATGGGCACATTTAATTCTCAGATGCTGGCCCCCCAAGTCCTGCCGATCATTTACGAAA
GGTGTTTTACCGAATGGGACTAAATGACAAG
GTGATGATGGTTTTTCATATGCTGTGGATGGCTTCTCAACATGCTTGTGATACTATTTCTCAACTGTATTATACACCTCCATATTCAGG
AAATAGTTGCATTGTCTGGTGCACACACCTTGGGAAGGTCCAGACCAGATCGTAGTGGTTGGGGAAAGCCAGAGACTAAGTATACG
GTATGAAACTAATACGATCTGATGTGACTTTGTA
TGACGAGAATCAAGAATCTGTATGCCTCATCTTGTAACGAGGTTACAAAATTCACCGCCATAGGTTGGAAAATGTCCAAAGAGAATGTTGCTTGTCAAACAAAAATAGTATATCTATTGA
CATCAAAACGTCCATTGTACAATTTTGCTTGCCAGACCTCCTAAAGATAAAAAGTCTGTATTGTTTGCAAGTCTTCGTAGGGAAAACATTGAGTAGCCTGATAAAAATTTCATTTGCCAT
TTGACTTGCCGTCTAGACACAAGTCAGTTGGAAGTGGAACGAATCGCAATCGTGATGTTAGCAATTATTGACCATATCAAGCTAAGAAACAAGGTTTAGGGATTTACATTGTGTCTTGTT
GTGGCAGAAAGATGGGCCTGGTGCACCTGGTGGTCAGTCGTGGACAGCAGAATGGCTGAAGTTTGATAATTCTTACTTCAAGGTATGAACCCGGAATGTAACTTTTTGTGCTGTAGTTAA
GCACCTTTATTATGAAGCCTGGAGTAAGGTCACGATGATGTCGGATTAACGATGCAGGATATCAAAGCACAAATAGATGAAGACCTACTTGTACTGCCAACTGATGCTGCTATTTTCGAA
GATCCTTCATTCAAG
GTGAAAGTGTCCGTCATCTTGATTGTAAATAGGGCGATTTTAGATAGCTTATTCAGCTAACTATACGTGATTTCTAACAGGTGTATGCTGAGAAGTATGCTGAAG
ATCAGGATGCTTTCTTCAAGGACTATGCTGAAGCACATGCCAAGCTCAGCAACCTAGGATCTAAGTTCGACCCTCCTGAG
GTATGTGTACCATAAACTCCTGAAATCAAATCAGTCGATG
CTCTAGCTACTTCAATGCACTAAATGGGCGATTTCTGAGCAGGGTATCGTATTGGACGGCGTTCAGGGTGAGAAGTTCGTGGCAGCTAATTACTCGTATGGAAAGGTACGTCCTGCTACA
ACTATTTTACGTAGTTATGTTCTGTTAGTAGAGCTGTCAAAAATGGACCTGACCGAGTCCTGTCTCAGTCCGATAAAATCCCATCCATGATCCAAAATGAACATAAGTCAACAATATGAA
ACTTGCCAAATGCAAAAACCGATGAACTCACAACATCAAGTGATACATGATCCATTAGAGCTGTAACGCGATGAACTTGTGACCGGATAGACTCGCGACCGATTGATCCTAACTCGATTA
ACCCACCCCATGACCCTCCTAATCCTTGACCATTCTACTGTCTAGCCAAAATATACACCATGTTTTCAAAGATGAAAGATATACCGAACAATACCGCTCAATGCCTGGCCGGAGTTGGTA
GAACGCAGACTCGGACCGAGAGAGATCCACAACGTCTTCACCCTACGTTGGATTTCCCTATGCCATAACAAATGTCACACTCTATTTACTTTCTTCGAGTACAGTGAACTTATATATACA
ACATTTTATTCATTCATTTTCACTTTCCATGATTTGATGCAGGAGTAAGAAAGAAAAAAACAAGTAACCGTGTTTACTACTACGGCATCATATAGTAATAGAAGGATGAATGAAGCCTAT
ATGAAAACCCAATACTACAAGTTAAAAAAAGCTCAGGAAGACAAAGGAATAAAGGAAAAATTCAAAATGAGTATGTGTTTTACTACTTATTTTGGATTTGCAGAGGGAGTTTTCAGACTC
CATGAAGCAGAAGATGCGTGCAGAGTATGAAGCAATTGGTGGTAGCCCCAGTAAGGCTCTTTCGTCTAATTACTTCCTGAACATCATTATTGTCATCTCTGTTCTTGCAGTTTTGACATA
TCTTTTTGGGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTGTCCATCTCACCTGCAACTATCCAAATCGCCGCAGCATCATTCGCCTCCACCACCATTTCAAATGGCTTCTTCAACTCTCAGCACGGCCGCCGCCGCCACGTCCTCTCGC
CTCCTCCTCCCTTCCTCCTCCACCACCGCTCGTGCTCACATCCGCCAACACCTCTCAACTTCTTCCACTCACGGCTTCTCTCCTCTCAAATGCATTCGATCCTCTCCTCTCCCTCCGTTT
CGCGCCTTCTCCAACCAG
AGGAGGCCGTTGAGCGCGGTCGCTGCTGCGTCCGATCCTGCTCAGTTGAAGAGCGCTAGGGAGGATATCAAGGAGATTCTCAAGTCCAAGTTCTGTCATCCG
ATTCTG
GTTCGATTGGGGTGGCATGATGCCGGGACGTACAACAAGGACATCGAGGAGTTCCCGATGAGAGGTGGAGCTAACGGAAGTCTTCGATTCGATATTGAGCTCAAGCACGGTGCA
AATGCTG
GGCTTGTCAATGCATTGAGTCTGCTTCAACCTATCAAAGAAAAGTATTCTGGTGTTACCTATGCTGATTTGTTCCAGTTAGCTAGTGCTACTGCCATTGAGGAAGCTGGCGGG
CCTAAAATCCCAATGAAATATGGAAGGGTAGATGTCTCTGCTCCAGAGGAATGCCCAGAGGAGGGAAGACTTCCTG
ATGCTGGCCCCCCAAGTCCTGCCGATCATTTACGAAAGGTGTTT
TACCGAATGGGACTAAATGACAAG
GAAATAGTTGCATTGTCTGGTGCACACACCTTGGGAAGGTCCAGACCAGATCGTAGTGGTTGGGGAAAGCCAGAGACTAAGTATACGAAAGATGGG
CCTGGTGCACCTGGTGGTCAGTCGTGGACAGCAGAATGGCTGAAGTTTGATAATTCTTACTTCAAG
GATATCAAAGCACAAATAGATGAAGACCTACTTGTACTGCCAACTGATGCTGCT
ATTTTCGAAGATCCTTCATTCAAG
GTGTATGCTGAGAAGTATGCTGAAGATCAGGATGCTTTCTTCAAGGACTATGCTGAAGCACATGCCAAGCTCAGCAACCTAGGATCTAAGTTCGAC
CCTCCTGAG
GGTATCGTATTGGACGGCGTTCAGGGTGAGAAGTTCGTGGCAGCTAATTACTCGTATGGAAAGAGGGAGTTTTCAGACTCCATGAAGCAGAAGATGCGTGCAGAGTATGAA
GCAATTGGTGGTAGCCCCAGTAAGGCTCTTTCGTCTAATTACTTCCTGAACATCATTATTGTCATCTCTGTTCTTGCAGTTTTGACATATCTTTTTGGGAACTAA

Retrieve as FASTA