Entry information : LuAPx97(Lus10018155|PACid:23145192)
Entry ID 12043
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-11 (Qiang Li)
Peroxidase information: LuAPx97(Lus10018155|PACid:23145192)
Name LuAPx97(Lus10018155|PACid:23145192)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuAPx97
start..stop
S start..stop
LuAPx137 811 0 1..433 1..434
MeAPx05 646 0 1..433 1..428
PtAPx07 622 0 1..433 1..424
PtAPx08 617 0 70..433 45..409
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 485293..485550 258 N° 2 485636..485743 108 N° 3 485823..485943 121 N° 4 486108..486208 101
N° 5 486336..486423 88 N° 6 486698..486765 68 N° 7 486854..486940 87 N° 8 487344..487415 72
N° 9 487532..487609 78 N° 10 487690..487794 105 N° 11 487878..487940 63 N° 12 488646..488798 153
join(485293..485550,485636..485743,485823..485943,486108..486208,486336..486423, 486698..486765,486854..486940,487344..487415,487532..487609,487690..487794,48787 8..487940,488646..488798)


exon

Literature and cross-references LuAPx97(Lus10018155|PACid:23145192)
DNA ref. Phytozome 11:   scaffold112 (485293..488798)
Protein sequence: LuAPx97(Lus10018155|PACid:23145192)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   434
PWM (Da):   %s   47132.03 Transmb domain:   %s   o413-432i
PI (pH):   %s   7.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHCPSHLQLSKSPQHHSPPPPFQMASSTLSTAAAATSSRLLLPSSSTTARAHIRQHLSTSSTHVFSPLKGIRSSPLPPLRAFSNQRRPLSAVAGASDPAQLKSAREDIKEILKSKFCHPILVRLGWHDAGTYNKDIEEFPRRGGANGSLRFDIELKHGANAGLVNALSLLQPIKEKYSGVTYADLFQLASATAIEAGGPKIPMKYGRVDVSAPEECPEEGRLPDAGPPSPADHLRKVFYRMGLNDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTAEWLLDSRMAEDIKAQIDEDLLVLPTDAAIFEDPSFKVYAEKYAEDQDAFFKDYAEAHAKLSNLGSKFDPPEGIILDGVQGEKFVAANYSYGKREFSDSMKQKMRAEYEAIGGSPNKALSSNYFLNIIIVISVLAVLTYLFGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTGTCCATCTCACCTGCAACTATCCAAATCGCCGCAGCATCATTCACCTCCACCACCATTTCAAATGGCTTCTTCAACTCTCAGCACCGCCGCCGCCGCCACGTCCTCTCGC
CTCCTCCTCCCTTCCTCCTCCACCACCGCTCGTGCTCACATCCGCCAACACCTCTCAACTTCTTCCACTCACGTCTTCTCTCCTCTCAAAGGCATTCGATCCTCTCCTCTCCCTCCGCTT
CGCGCCTTCTCCAACCAG
GTCCTCCTCTTCCTTCCTTTGCTTTGTATTCAGCTTCCGTTTGCTTATTGTGCGTCGCTTAATGCTGTTCTTATGGAATTTGCAGAGGAGGCCGTTGAGCGC
GGTCGCTGGTGCGTCTGATCCTGCTCAGTTGAAGAGCGCTAGGGAGGATATCAAGGAGATTCTCAAGTCCAAGTTCTGTCATCCGATTCTG
GTGCTTGTTGCCTTCTGCTTGTATTTTAT
TGACTTCCGTTTGTTTTTCTTCTTGTATTTGAACTGTTGTTCTTCTATAGGTTCGATTGGGGTGGCATGATGCCGGGACGTACAACAAGGACATCGAGGAGTTCCCGAGGAGAGGTGGAG
CTAACGGAAGTCTTCGATTCGATATTGAGCTCAAGCACGGTGCAAATGCTG
GTATAAACTTCTTCCTGACTATGTTGTAGTTGTAGTTTGCCTTTTGAATTTCTGAGCTGGTGAAGAGTA
GAGGAGAATCACGCAAGTGGTGACGGTTTCTTGCTGTTTGGATAGAATGTATCCTGTCATCTGCTGATGGATTGGATTGTGTGATCTCATTTCAGGGCTTGTCAATGCATTGAGTCTGCT
TCAACCTATCAAAGAAAAGTATTCTGGTGTTACCTATGCTGATTTGTTCCAGTTGGCTAGTGCTACTGCCATTGAG
GTAGGACATTTGCTCTTAATGTGCTGATTATTGGAGCTCAAGTT
GTTCTCAAGCAAGAAGAAAGAGTTGAATGCCCGATACTAAACTGTAGTTGTTGATATTACATTATGTGGATTGATTATCTTAGGAAGCTGGCGGGCCTAAAATCCCAATGAAATATGGAA
GGGTAGATGTCTCTGCTCCAGAGGAATGCCCAGAGGAGGGAAGACTTCCTG
GTGAGTGTGCTAAACTTGCTGCTATTGTGCCTGGAAAAATTCGAGTTAAATGTACTGTGATGGCTGTTT
AGAAGGTGAACATTTGAGTTCTGTGAGATTCTTCATTCCTGGGGATAAAAACGAATATGAATACTGGGAATGAGATCCGGGATCACCAGCTGACACGATTTTGTAACATGTTAGAGGGAC
TTAAGATTTTATCATTGTTCTCTCTGGAAAAGGAGTCTGTTTTTTGCTTGAATCTTTTATAATGAATGGCACATTTAATTCTCAGATGCTGGCCCCCCAAGTCCTGCCGATCATTTACGA
AAGGTGTTTTACCGAATGGGACTAAATGACAAG
GTGATGATGGTTTTTCATATGCTGTGGATGGCTTCTCAACTTGCTTGTGATACTATTTCTCAACTGTGTTATACGCCTCCATATTCA
GGAAATAGTTGCATTGTCTGGTGCACACACCTTGGGAAGGTCCAGACCAGATCGTAGTGGTTGGGGAAAGCCAGAAACTAAGTATACGGTATGAAACTAATACGATCTGATGTGACTTTG
TATGATGAGAATCAAGAATCTGTATGCCTCATCTTGTAACGAGGTTACAAAATTCACCGCCATCGGTTGGAAACTGTCCAAAGAGAATGTTGCTTGTCAAACAAAAATAGTATATCGATT
GACATCAAAACGTCCATTGTACAATTTTGCTTGCCAGACCTCCTAAAGATAAAAAGTCTGTATTGTTTGCAAGTCTTCGTAGGGAAAACATTGAGTAGCCTGATAAAAATTTCATTTGCC
ATTTGACACTTGCCGTCTCGACACAAGTCAGTTGGAAGTGGAACGAATCGCAATCGTGATGTTAGCAATTATTGACCATATCAAGCTAAGAAACAAGGTTTAGGGAGTTACATTGTGTCT
TGTTGTGGCAGAAAGATGGGCCTGGTGCACCTGGTGGTCAGTCGTGGACAGCAGAATGGCTGTTGGACAGCAGAATGGCTGAAGTTCGATAATTCTTACTTCAAGGTATGAACCCAGAAT
GTAATTTTTCGTGCTGTAGTTAAGCACCTTATTATGAAGCCTGGAGTAAGGTCACGATGATGTCGGATTAACGATGCAGGATATCAAAGCACAAATAGATGAAGACCTACTTGTACTGCC
AACTGATGCTGCTATTTTCGAAGATCCTTCATTCAAG
GTGAAAGTGTCCGTCATCTTGATTGTAAATAGGGCGATTTTAGATAGCTTATTCAGCTAACTATACGTGATTTCTAACAGGTG
TATGCTGAGAAGTATGCTGAAGATCAGGATGCTTTCTTCAAGGACTATGCTGAAGCCCATGCCAAGCTCAGCAACCTAGGATCTAAGTTCGATCCTCCTGAG
GTATGTGTACCATAAACT
CCTGAAATCAAATCAGTCGATGCTCTAGCTACTTCAATACACTAAATGGGCGGATTTCTGAGCAGGGTATCATATTGGACGGCGTTCAGGGTGAGAAGTTCGTGGCAGCTAATTACTCGT
ATGGAAAG
GTACGTCCTGCTACAACTATTTTATGTAGTTATGTTCTGTTAGTAGAGCTGTCAAAAACTGACCCGGCCAAGTCCTGTCCCAGCCCGATAAAATCCCATCAATGATCCAAAA
TGAACATAAGTCAACAACATGAAACTTGCCAAATGCAAAAACTGATGAACTCACAACCTCAAGTGATACATGATCCATTAGAGCTGTAACCCGATGAACTTGTGACCGGATAGACTCGCG
ACTGATTGATCGTAACTCGATTAACCCACCCCATGACCCTCCTAATCCTTGACCATTCTACTGTTTAGCCAAAATATACACTCTGTTTTCAAAGATGAAAGATATACCAAACAATACCGC
TCAATGCCTGGCCGGAGTCGGACCGAGAGAGATCCACAACGTCTTCTACGTTGGATTTCCTTATGTCATAACAAATGTCACACTCTATTTACTTTCTTCAAGTACAGTGAACTTATATAT
ACAACATAGTATTCATTCATTTTTCACTTTCCATGATTTGATGCAGGAGTAAGAAAGAAAAAAACAAGTAACCGTGTTTACTACTATGGTATCGTATCATATAATAATAGAAGGATGAAT
GAAGCCTATTTGAAAACCCAATACTACAAGTTAAAAAACAAACTCAGGAAGACAAGGAATAAAGGAAAAATTCAAAATGAGTATGTGTTTTACTACTTATTTTGGATTTGCAGAGGGAGT
TTTCAGACTCCATGAAGCAGAAGATGCGTGCAGAGTATGAAGCAATTGGTGGTAGCCCCAACAAGGCTCTTTCGTCTAATTACTTCCTGAACATCATTATTGTCATCTCTGTTCTTGCAG
TTTTGACATATCTTTTTGGGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTGTCCATCTCACCTGCAACTATCCAAATCGCCGCAGCATCATTCACCTCCACCACCATTTCAAATGGCTTCTTCAACTCTCAGCACCGCCGCCGCCGCCACGTCCTCTCGC
CTCCTCCTCCCTTCCTCCTCCACCACCGCTCGTGCTCACATCCGCCAACACCTCTCAACTTCTTCCACTCACGTCTTCTCTCCTCTCAAAGGCATTCGATCCTCTCCTCTCCCTCCGCTT
CGCGCCTTCTCCAACCAG
AGGAGGCCGTTGAGCGCGGTCGCTGGTGCGTCTGATCCTGCTCAGTTGAAGAGCGCTAGGGAGGATATCAAGGAGATTCTCAAGTCCAAGTTCTGTCATCCG
ATTCTG
GTTCGATTGGGGTGGCATGATGCCGGGACGTACAACAAGGACATCGAGGAGTTCCCGAGGAGAGGTGGAGCTAACGGAAGTCTTCGATTCGATATTGAGCTCAAGCACGGTGCA
AATGCTG
GGCTTGTCAATGCATTGAGTCTGCTTCAACCTATCAAAGAAAAGTATTCTGGTGTTACCTATGCTGATTTGTTCCAGTTGGCTAGTGCTACTGCCATTGAGGAAGCTGGCGGG
CCTAAAATCCCAATGAAATATGGAAGGGTAGATGTCTCTGCTCCAGAGGAATGCCCAGAGGAGGGAAGACTTCCTG
ATGCTGGCCCCCCAAGTCCTGCCGATCATTTACGAAAGGTGTTT
TACCGAATGGGACTAAATGACAAG
GAAATAGTTGCATTGTCTGGTGCACACACCTTGGGAAGGTCCAGACCAGATCGTAGTGGTTGGGGAAAGCCAGAAACTAAGTATACGAAAGATGGG
CCTGGTGCACCTGGTGGTCAGTCGTGGACAGCAGAATGGCTGTTGGACAGCAGAATGGCTGAA
GATATCAAAGCACAAATAGATGAAGACCTACTTGTACTGCCAACTGATGCTGCTATT
TTCGAAGATCCTTCATTCAAG
GTGTATGCTGAGAAGTATGCTGAAGATCAGGATGCTTTCTTCAAGGACTATGCTGAAGCCCATGCCAAGCTCAGCAACCTAGGATCTAAGTTCGATCCT
CCTGAG
GGTATCATATTGGACGGCGTTCAGGGTGAGAAGTTCGTGGCAGCTAATTACTCGTATGGAAAGAGGGAGTTTTCAGACTCCATGAAGCAGAAGATGCGTGCAGAGTATGAAGCA
ATTGGTGGTAGCCCCAACAAGGCTCTTTCGTCTAATTACTTCCTGAACATCATTATTGTCATCTCTGTTCTTGCAGTTTTGACATATCTTTTTGGGAACTAA

Retrieve as FASTA