Entry information : LuKat71(Lus10012258|PACid:23172676)
Entry ID 12057
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuKat71(Lus10012258|PACid:23172676)
Name LuKat71(Lus10012258|PACid:23172676)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuKat71
start..stop
S start..stop
LuKat 991 0 1..492 1..492
GhKat01 981 0 1..492 1..492
PtKat01 976 0 1..492 1..492
PdelKat01 975 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 285399..285413 15 N° 2 285091..285187 97 N° 3 284393..284670 278 N° 4 283340..284116 777
N° 5 283067..283156 90 N° 6 282727..282794 68 N° 7 282539..282632 94 N° 8 282390..282449 60
complement(join(282390..282449,282539..282632,282727..282794,283067..283156,2833 40..284116,284393..284670,285091..285187,285399..285413))


exon

Literature and cross-references LuKat71(Lus10012258|PACid:23172676)
DNA ref. Phytozome 11:   scaffold273 (285413..282390)
Protein sequence: LuKat71(Lus10012258|PACid:23172676)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   56863.17  
PI (pH):   %s   7.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSAFNSPFWTTNSGAPVWNNNSSMTVGARGPILLEDYHLVEKIANFDRERIPERVVHARGASAKGFFEVTHDISNLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDMVGNNFPVFFIRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLFDDIGIPQDYRHMEGSGVNTYTLVSKSGKAYYVKFHWKPTCGVKSLLEDEAIKVGGANHSHATQDLYDSIAAGNYPEWKLFIQTIDPDHEDRFDFDPLDVTKTWPEDIIPLQPVGRLVLNKNIDNFFAENEQLAFCPALVVPGVYYSDDKLLQTRIFSYSDTQRHRLGPNYLQLPANSPKCSHHNNHHEGFMNFMHRDEEVNYFPSRYDPVRHAEQFPVPPQVCTGKREKCVITKENNFKQPGERYRSWPADRQERFICRWIDALSDPRVTHEIRSIWISYWSADQSLGQKLANRLNVRPNI*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGGTACGTAGCGACTTTGCTTTGATTATCTATTCGCGGGTGATTTCAGTTTAACCGGAACCCTAATTTCTGTTGGGATTTCAGATTACGCTTCCTCCATTTCCGTTT
ATATCAATATCTGTTACTGGTGATTAGCTTTGTTGTTCTAAGTCTATTATTGATTGATGGAGCCTTGTTGTTTGGTTTTTTGGGCGTGGTGTTTTTCCATCTGCAGCATCGTCCTTCCAG
TGCTTTCAACTCTCCTTTCTGGACTACCAACTCCGGCGCTCCAGTATGGAACAACAACTCTTCCATGACTGTTGGAGCTAGAG
GTACTTCTTTTCCTTGTCAAAATTCTTAACGTGACTG
ATCCATTGAATTGCTGGGTCCCTATTACTGTTTTATAATCTCAGTAGTCTTCGTTAGAATCCGGTCAATATACTGTATTGGTTTCACTTTGATATCCATATCCTCTTATGGGCTGTGATT
TTAGCTTACTTTTTGTGCTGTTTGGTATGTCTTTTTGGGTGTCAGACTTGTGCGCTATGATATTTTGAATTGGGTTTCAGAAATTAAGTTGCGTGCTTACAATTATTTGATTCTATCTGG
TATGATTTTGGCGGTTTGGGACTTTCTCCATAGAGAAGAGGTGTTCTGTATGAATATAAGCTTGAGTGTTATTTGTGTAGAAGCAAAAAGGGGAGATTTCAACTTCTTCATGGCTTCTTG
TAATTTTGTTTTTGTTTTAACAGGTCCGATTCTCCTTGAGGATTATCATTTGGTGGAGAAGATAGCCAACTTCGATAGGGAGCGCATTCCAGAGCGTGTTGTCCACGCCAGGGGAGCAAG
TGCAAAGGGTTTCTTTGAAGTCACCCACGATATCTCTAATCTCACTTGTGCTGATTTCCTCCGAGCTCCTGGAGTTCAGACACCCGTGATAGTCAGGTTCTCCACTGTTATCCATGAACG
TGGTAGCCCTGAAACTCTGAGAGACCCTAGGGGTTTTGCAGTGAAGTTCTACACCAGAGAG
GTAGCTAAACTTTTGTCGTCAGAATAGATTCATCATTCGTGGCGTGGTCTGTATTTTTC
TGGTGGTCTTTCTATCAGTATATTAATCTACGTGCCATCTTGTTTCTTCTTTCCTCATATGTGTAGACCCTTTAATTATGTTTGTGCCAAAGGGCTTCTTTTGTTTTCTTCTTAGTAATT
GCTCGAGTAACCATATCCATCTTCATTTAGCAACCTGCTCATTGAAGTATTCGATGTTCAGTTTTGGATATCTTACTACTCCTTGCTCTTATTGCAGGGAAATTTTGATATGGTTGGAAA
CAACTTTCCAGTTTTCTTCATTCGTGATGGAATGAAGTTCCCCGACATGGTACATGCCCTGAAGCCAAATCCTAAATCTCACATTCAGGAGAACTGGAGAATCCTGGATTTCTTCTCCCA
TCATCCCGAAAGTCTGCACATGTTTTCGTTCCTCTTTGACGATATTGGTATTCCTCAAGATTACAGACACATGGAGGGTTCTGGCGTTAACACCTATACATTAGTGAGCAAGTCTGGAAA
AGCTTACTATGTCAAATTTCACTGGAAACCCACTTGTGGAGTGAAGAGTCTGTTGGAGGATGAGGCGATCAAGGTTGGCGGAGCTAATCACAGCCATGCTACCCAAGATCTCTATGATTC
AATTGCAGCTGGAAATTACCCAGAGTGGAAGCTGTTCATCCAGACCATCGATCCTGATCATGAAGATCGATTTGATTTTGACCCACTTGACGTGACCAAGACCTGGCCTGAAGATATCAT
ACCTCTTCAACCAGTTGGTCGCCTGGTCTTAAACAAGAACATTGATAACTTCTTTGCTGAAAATGAGCAGCTTGCATTCTGCCCAGCACTTGTGGTGCCTGGTGTTTACTATTCAGATGA
CAAGCTACTTCAGACTCGCATCTTCTCTTACTCTGACACTCAAAGGCACCGTCTTGGACCAAACTATCTGCAGCTCCCTGCTAATTCTCCCAAGTGCTCTCACCACAACAATCATCATGA
AGGTTTCATGAATTTCATGCACAGGGATGAAGAG
GTATTTTTCTCGTTCAACCTATAAATAATTTATATGATTGGACTATAGTGACCTTTTAGTTCTCCGTAGCATGACCTTTATATTCA
AACCTCATCCTGTACTGAGTAATCACAAACAACCAAGAAAAATTCAAACCCTTGTTTTTGCTCCTGTTGTAACCCCATTTTTCATGCTACTTTTTAGGTCAATTACTTCCCATCAAGGTA
TGATCCAGTTCGCCATGCTGAGCAATTCCCTGTTCCTCCTCAAGTCTGCACTGGAAAGCGTGAGAAG
GTCAGCTATTATGCTAGTTATTCTTTTCATTTTATGACTTTGGATTGTTAGGC
TTTAGACAGTAGTCAAATATGTTCATTTCTCTAACAACACTGTTAGCCGCTTAATGCTGCGCTTTTACCTTTGCTACTCTTGCATGCGTCTGCACCTATCTGTGTTGGAGCAAGAGAAAA
ATCCACTGATATCTTGTGCACATTAGCACGAAATCACGAATGTCTTCAGTAAGAACCTAAACTTACATGTTTGGCTTTTCTCTTGGCTGTTTATTGCAGTGTGTGATAACCAAGGAGAAC
AACTTCAAGCAACCTGGGGAGAGATACCGCTCATGGCCGGCTGACAG
GTAAAATCCATTAACCCTGACCATTCATTCTCTTGCAGTAAAATGTGTTTCTGTGCTATTCATAACAGTTCCT
AAATCCACAATGTGTATTCAGGCAAGAAAGATTCATCTGCCGATGGATCGACGCACTTTCTGATCCCCGCGTCACTCATGAAATCCGCAGTATCTGGATATCATACTGGTCACAGGTCAG
AAAACCCTTTCTTTTTTCAATAACGTCTGGAAGTAAACGACTTGTGTGTTATGATCCTAACACTGTGGTGTGGTTTTGTTGCAGGCTGATCAGTCACTTGGTCAGAAGCTGGCAAACCGT
CTCAACGTGAGGCCAAACATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGCATCGTCCTTCCAGTGCTTTCAACTCTCCTTTCTGGACTACCAACTCCGGCGCTCCAGTATGGAACAACAACTCTTCCATGACTGTTGGAGCTAGAGGTCCGATT
CTCCTTGAGGATTATCATTTGGTGGAGAAGATAGCCAACTTCGATAGGGAGCGCATTCCAGAGCGTGTTGTCCACGCCAGGGGAGCAAGTGCAAAGGGTTTCTTTGAAGTCACCCACGAT
ATCTCTAATCTCACTTGTGCTGATTTCCTCCGAGCTCCTGGAGTTCAGACACCCGTGATAGTCAGGTTCTCCACTGTTATCCATGAACGTGGTAGCCCTGAAACTCTGAGAGACCCTAGG
GGTTTTGCAGTGAAGTTCTACACCAGAGAG
GGAAATTTTGATATGGTTGGAAACAACTTTCCAGTTTTCTTCATTCGTGATGGAATGAAGTTCCCCGACATGGTACATGCCCTGAAGCCA
AATCCTAAATCTCACATTCAGGAGAACTGGAGAATCCTGGATTTCTTCTCCCATCATCCCGAAAGTCTGCACATGTTTTCGTTCCTCTTTGACGATATTGGTATTCCTCAAGATTACAGA
CACATGGAGGGTTCTGGCGTTAACACCTATACATTAGTGAGCAAGTCTGGAAAAGCTTACTATGTCAAATTTCACTGGAAACCCACTTGTGGAGTGAAGAGTCTGTTGGAGGATGAGGCG
ATCAAGGTTGGCGGAGCTAATCACAGCCATGCTACCCAAGATCTCTATGATTCAATTGCAGCTGGAAATTACCCAGAGTGGAAGCTGTTCATCCAGACCATCGATCCTGATCATGAAGAT
CGATTTGATTTTGACCCACTTGACGTGACCAAGACCTGGCCTGAAGATATCATACCTCTTCAACCAGTTGGTCGCCTGGTCTTAAACAAGAACATTGATAACTTCTTTGCTGAAAATGAG
CAGCTTGCATTCTGCCCAGCACTTGTGGTGCCTGGTGTTTACTATTCAGATGACAAGCTACTTCAGACTCGCATCTTCTCTTACTCTGACACTCAAAGGCACCGTCTTGGACCAAACTAT
CTGCAGCTCCCTGCTAATTCTCCCAAGTGCTCTCACCACAACAATCATCATGAAGGTTTCATGAATTTCATGCACAGGGATGAAGAG
GTCAATTACTTCCCATCAAGGTATGATCCAGTT
CGCCATGCTGAGCAATTCCCTGTTCCTCCTCAAGTCTGCACTGGAAAGCGTGAGAAG
TGTGTGATAACCAAGGAGAACAACTTCAAGCAACCTGGGGAGAGATACCGCTCATGGCCGGCT
GACAG
GCAAGAAAGATTCATCTGCCGATGGATCGACGCACTTTCTGATCCCCGCGTCACTCATGAAATCCGCAGTATCTGGATATCATACTGGTCACAGGCTGATCAGTCACTTGGTCAG
AAGCTGGCAAACCGTCTCAACGTGAGGCCAAACATTTAA

Retrieve as FASTA