Entry information : LuPrx106(Lus10020045|PACid:23156208)
Entry ID 12066
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-01-10 (Bruno Savelli)
Peroxidase information: LuPrx106(Lus10020045|PACid:23156208)
Name LuPrx106(Lus10020045|PACid:23156208)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx106
start..stop
S start..stop
LuPrx34 627 0 1..323 1..336
EguPrx75 540 0 5..320 4..331
EgrPrx75 540 0 5..320 4..331
EcamPrx75 535 0 5..320 2..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 567041..567283 243 N° 2 567369..567549 181 N° 3 567760..567894 135 N° 4 567966..568378 413
join(567041..567283,567369..567549,567760..567894,567966..568378)


exon

Literature and cross-references LuPrx106(Lus10020045|PACid:23156208)
DNA ref. Phytozome 12:   scaffold23 (567041..568378)
Protein sequence: LuPrx106(Lus10020045|PACid:23156208)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (302)
PWM (Da):   %s   37007.78 (34461.5)  
PI (pH):   %s   8.32 (8.38) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHHKALFYLCFLSLTVSAFAQQESISNEETKTTGLVMDFYKDSCPQAEDIIREQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRSLSEKETDRSFGLRNFRYLDTIKEAVERECPGVVSCADIEQDSKFGERRRDGRKSRAEILEEYLPDHNESMSVVLDRFAAMGIDTPGLVALLGSHSVGRTHCVKLVHRLYPDVDPALNPDHVGHMLKKCPNPIPDPKAVQYVRNDRGTPMILDNNYYRNILENKGLLIVDHQLATDKRTKPYVKKMAKSQDYFFKHFARAITKLSENNPLTGDKGEIRRQCSVVNKVIH*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCATCACAAAGCTCTCTTCTACTTGTGCTTCTTATCCTTAACAGTCTCAGCATTTGCTCAACAAGAGTCCATCAGCAATGAAGAAACCAAAACAACAGGGCTAGTGATGGACTTC
TACAAGGACAGCTGCCCTCAAGCAGAGGACATAATCAGAGAGCAAGTCAAGCTTCTGTACAAGAGGCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGACTGCGCTGTT
CAG
GTAAATTGAACAACAATTGAACTTCAGTTTCAGAATTCCGAAATGTTTTCTTGTCGGTTTTGCCTGATGATGCTGCTTTTTTCAGTCGTGTGATGCTTCCCTGCTGTTGGATTCAAC
GAGGAGGTCTCTGTCTGAAAAGGAGACAGACAGGAGCTTTGGTCTGAGGAATTTCAGGTATCTTGACACCATCAAAGAAGCTGTGGAGAGGGAATGCCCTGGTGTCGTCTCCTGTGCTGA
CATTGAGCAAGATTCTAAATTTGGAGAGA
GTTTGAAAACACACGGGGCAAAATTCTGGCTATAAAACTTAAATTTTGAAAATTGTACATATGATTTGGTTACTTTGGAACCGATTGGATA
GACTATAGGCAGTGGTCTAGGTTCATTTACTCCTGATTCAGCCGGTAGTGAACTTATGTGTTGATTAAATCATGGAACTTTGATGCAGTTGGGAGGACCACACATACCACTAAAAACAGG
AAGAAGGGATGGAAGGAAGAGCAGAGCAGAAATCCTTGAGGAATATCTTCCAGATCATAATGAGAGCATGTCTGTAGTCCTTGACAGGTTCGCCGCCATGGGGATCGATACTCCTGGACT
CGTTGCCTTGCTAG
GTATAACCTGATAACTAGAGTTGTTAGAGATTGATTTTTATATGATTCACTAACATATACATATTATACAGGGTCCCACAGCGTGGGAAGAACCCACTGCGTGAAG
CTGGTTCATCGTCTCTACCCGGACGTTGATCCAGCTTTGAACCCTGACCATGTCGGCCACATGCTGAAGAAATGCCCCAACCCGATCCCAGACCCGAAGGCAGTGCAGTATGTGCGAAAT
GACCGCGGCACCCCTATGATTCTGGACAACAACTACTACAGGAACATACTTGAGAACAAAGGGTTGTTGATCGTGGATCACCAGCTTGCTACCGACAAGAGGACTAAGCCTTATGTGAAG
AAGATGGCTAAGAGCCAGGACTACTTCTTCAAGCACTTCGCCAGGGCAATCACCAAGCTTTCGGAGAACAACCCTCTCACTGGGGATAAGGGTGAGATTAGGAGGCAGTGCAGCGTTGTC
AACAAGGTGATCCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCATCACAAAGCTCTCTTCTACTTGTGCTTCTTATCCTTAACAGTCTCAGCATTTGCTCAACAAGAGTCCATCAGCAATGAAGAAACCAAAACAACAGGGCTAGTGATGGACTTC
TACAAGGACAGCTGCCCTCAAGCAGAGGACATAATCAGAGAGCAAGTCAAGCTTCTGTACAAGAGGCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGACTGCGCTGTT
CAG
TCGTGTGATGCTTCCCTGCTGTTGGATTCAACGAGGAGGTCTCTGTCTGAAAAGGAGACAGACAGGAGCTTTGGTCTGAGGAATTTCAGGTATCTTGACACCATCAAAGAAGCTGTG
GAGAGGGAATGCCCTGGTGTCGTCTCCTGTGCTGACATTGAGCAAGATTCTAAATTTGGAGAGA
GAAGAAGGGATGGAAGGAAGAGCAGAGCAGAAATCCTTGAGGAATATCTTCCAGAT
CATAATGAGAGCATGTCTGTAGTCCTTGACAGGTTCGCCGCCATGGGGATCGATACTCCTGGACTCGTTGCCTTGCTAG
GGTCCCACAGCGTGGGAAGAACCCACTGCGTGAAGCTGGTT
CATCGTCTCTACCCGGACGTTGATCCAGCTTTGAACCCTGACCATGTCGGCCACATGCTGAAGAAATGCCCCAACCCGATCCCAGACCCGAAGGCAGTGCAGTATGTGCGAAATGACCGC
GGCACCCCTATGATTCTGGACAACAACTACTACAGGAACATACTTGAGAACAAAGGGTTGTTGATCGTGGATCACCAGCTTGCTACCGACAAGAGGACTAAGCCTTATGTGAAGAAGATG
GCTAAGAGCCAGGACTACTTCTTCAAGCACTTCGCCAGGGCAATCACCAAGCTTTCGGAGAACAACCCTCTCACTGGGGATAAGGGTGAGATTAGGAGGCAGTGCAGCGTTGTCAACAAG
GTGATCCATTGA

Retrieve as FASTA