Entry information : LuPrx120(Lus10021956|PACid:23157995)
Entry ID 12077
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-30 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-28 (Qiang Li)
Peroxidase information: LuPrx120(Lus10021956|PACid:23157995)
Name LuPrx120(Lus10021956|PACid:23157995)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx120
start..stop
S start..stop
LuPrx207 556 0 1..352 1..346
MePrx105 400 2e-140 27..351 30..341
LuPrx208 387 6e-135 2..351 1..346
RcPrx24 386 1e-134 26..353 23..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 742176..742469 294 N° 2 741896..742087 192 N° 3 741639..741804 166 N° 4 740664..741067 404
N° 5 731094..731102 9  
complement(join(731094..731102,740664..741067,741639..741804,741896..742087,7421 76..742469))


exon

Literature and cross-references LuPrx120(Lus10021956|PACid:23157995)
DNA ref. Phytozome 11:   scaffold164 (742469..731094)
Protein sequence: LuPrx120(Lus10021956|PACid:23157995)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (328)
PWM (Da):   %s   38093.25 (35224.7) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.4 (8.21) Peptide Signal:   %s   cut: 27 range:27-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSTKTAIAFFFLSLLLFVLPYASHAKGHNGNNGRRGRRDDNGQGKGNGRPDLPPSPILKDCPQFETVARDITWSRVAADPTLAPKLLRLHYHDCFVRGCDASILLDSTATNSAEKDAIPNRSLAGYEVIDEIKARLEAVCPATVSCADILTLAARDAVSFQFKRAMWPVFAGRKDGRVSMASEVPTNLPSPSGNITTLIRQFRNKGLDLQDLVALSGAHTIGVSRCRVISRRLFNFTGRGDTDPSIAPGLASTLKAQCSNPGGGAGVTLEMDPGSSTSFDAHYYQALDQNQGLFQSDAALMTDQRSALLSRILASNDDQLFFATFARSMVKMGAIVDGDGTEGEIRRNCRAK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Extra 3' end.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCCACTAAGACAGCCATCGCCTTCTTCTTCCTTTCTCTCTTGCTTTTCGTCCTACCTTATGCCTCTCATGCCAAAGGCCATAACGGCAACAATGGTCGGCGGGGTCGGAGAGAC
GACAACGGCCAAGGTAAGGGAAATGGACGGCCGGATCTGCCGCCATCTCCAATCCTGAAGGACTGCCCACAGTTTGAAACGGTCGCTAGGGATATTACTTGGAGTAGGGTTGCTGCTGAC
CCTACCTTGGCTCCCAAGCTACTCAGGCTGCACTATCATGATTGCTTTGTCAGG
GTTAGCCTCTCCTCACTAATCTATGTAATTGGCTAGCTAGGTAGCTTTGACAATACTGATGATGTA
AATTAAATGTTAATTAATGTAGGGTTGTGACGCGTCCATATTGCTGGATTCGACGGCTACGAATTCAGCAGAGAAAGATGCAATTCCAAATAGATCGTTAGCAGGGTACGAGGTTATCGA
CGAGATTAAAGCTCGATTAGAAGCGGTTTGCCCCGCAACTGTCTCGTGTGCTGATATCCTTACATTGGCTGCGAGAGATGCTGTTTCTTTTCAG
GTATTTAAAACTTTATGAAGTAGTGT
GCGTGTGTATATATATAACTTGTTGTTAGTTGGAGTTTAATTGATCATCAAATTCGGCCACGCAGTTCAAAAGGGCAATGTGGCCGGTTTTCGCCGGGAGGAAGGATGGTCGAGTTTCTA
TGGCATCTGAAGTGCCAACGAACTTACCATCTCCATCCGGAAATATTACTACGCTCATCCGACAATTCCGAAACAAAGGACTCGATCTTCAAGATCTCGTCGCGTTGTCAG
GTATCGTAA
TAATAATAATAATTAATGTCCCAACGCAATATGGGCCCTTGGATTTACACAAGACTTCAGGGCTAAGATTAATCAGGGGTAATTTGGTCATATTATTTTAAATATTTTTGTTGGACTATA
ACCAAGCCATGTCTGATCGCTGGACCACAATGTCTGGTTTCCGGTCACAAGAAAATTTCCCAATCAATTTTTTGCCGATTCCGACATTTTTTTAACGAAATTTGTTGCACCCACACGCTC
TCTGTCGTCGGCTCTACGTATCTGGAAATTTTTTATTTTTTTAAAAATAATTTCTGACGTCCGATCGTGCAACTTTATAATATTAGATATACGATTGTATACAAATTTTTTATTTTTTTG
AAAGTATATAGTATTTAATATATAAATATGTATGACTGTGAAATGTTAATTTTGCCCGTATTTTCGGCCATTAGATTTAAGATATTAGATAGATGGCTAAAATTTATAATGTGGACTTTG
TAAATCCGATCCAAAGTCATTTCTCTGATTCCGAATTCTGACTCCAATCTCACTATCAATATATCATTGATTTCTCAAACAGGCGCCCACACAATCGGGGTGAGTCGGTGCAGGGTGATA
TCGAGGAGGCTGTTCAACTTCACCGGAAGAGGGGACACCGACCCGTCGATTGCGCCAGGACTCGCTAGTACCCTTAAGGCACAATGTTCCAACCCAGGTGGTGGTGCTGGAGTAACCTTG
GAGATGGATCCTGGAAGCTCAACTTCCTTTGACGCTCACTACTACCAGGCCTTGGACCAGAACCAGGGACTCTTTCAAAGCGATGCTGCACTGATGACGGACCAGCGGTCGGCTCTACTC
AGCCGGATTTTGGCAAGTAATGATGATCAGCTTTTCTTCGCCACGTTTGCTCGGTCGATGGTGAAGATGGGCGCCATTGTCGACGGTGATGGCACCGAAGGAGAGATTAGGAGGAACTGT
CGCTTT
GTTAATTAATTTGACTGATTAATTAATTAATACTGATACATGAGGAGTCAGAAGCACATGGCATATTAAATGGGAGCCTACATAATAAAATTATCAAAATATGAACTCGTTTGT
TAGGGATTGATACGTTGAAGATGGACAGTTTCGTAATTTGCCTAACAACAACATCGCTAAATATGATACTCGTCAAAGTTTTTCGTTATATATTCATTCACACAATAATTAAATTAATTA
ATTAGCTCCAAAATTCATAGGTCCAAGGGAGAAATTGAGTTGGGAAATCAGATACAAAATCGCTTTAGGAACTGCTAACGGGCTTCTGTATCTTCACCAGAGTTATTTGAACGAGTTATT
TTAATGAGTAGATCGTTTGAATGAGGGCCAAAATACATTGTTTGTTATCGGAAACAATAATCGTGATATTTGAAATAACTCGAATACCTAGGAATCGAGTTAATTCAAAGCACATTACTC
ATTGCTTTATGTGAGTCAAACAAGGTAATCTTCACATCTCAAATGTTTTGCACCTCGAGGAGAATACCACATCCCCTAATAATGGATTCATTTTGCTCCTAGAAAATATCACAATCCGAA
ATACCATTAATTTTTATGTTATATGCCAAACGAGTTATTTTGAGTCAACTAACTCGCAACGAATTCTTTCGGGCTAAATACTTTTTATCACAGATTTCAGATTTTGGACTTGCAAAATGG
TTACCAGAGAATTGGACTCATCATACTGTATCAAAAAATCGAAGGCACTTTTGGGTTTGTAATACTAACCAATTCCACTAATTATTCATTGTGAATTTTTTTACTTAATTACTTATAAAT
CACTGGTGGCTATAAACAGTTACCTCCCACCTGAGTTCTTCATGCATGGTATGGGGTGCTATTATTAGAGCTCATCACAGGAAGACAACCTAGCTATTTGAATAAATTCTCTCTGTTTCA
GGCAAAACCATTCCTGATGCAGAACAAGATCGGGGACCTTGTCGATCCGGTTCTTGGGGAATCTTACGATTCGGAGGAAATGGGACGAGCCGTCTTTTTAGCTGCTATGTGCGTGGAACA
GGCCTCGGTACAGCGGCCACAAATGAAGCAGGCAGTGGAGATTCTGATGGGTGATGAGAGCACCTTGGAAGAATGTAAACATATGCACAAGCCTAAGCTGCAAAGGACATACTCCGAGGA
GCTTTTGGATGCGGACGAGTACAACTCAACAACATAGTTGTGTGATCTGAACATATGTTTGGATGATCTTCTGGAATCGGATGATGATGTTGAGGTTGAGGTTGAGGCTTATCGAGAATG
TGGCTCGAACAAGGTACCTCCGTCAGATGAAGCAGAGGAGAGATCCAGCCATGAAGATGAGGAAACAATCGGGGGCCAGAAACCAAAAGACACTTTGTGATTGGTGCAATGCTCAATGAA
AGCTAACCCACAGTTAAAACGTAAGAAACGTGGAATTAAGCAAAGATTAGAGATCCTTGACGATGAACATGACTTAATATTAGAAGCCACGTCTGAGAAAATCACGGCCGAAAACGCTGA
TCCACTCTCTGCTCCAAACATTCATTCCCAGGAGTAGAAGCAAGCAAAACCATTTCCCCACTCCGCCAATCTTTTACGTATAAGCAAACATGATATCCAAAAACCGTTTCACAATTCTTA
TAAGTACCACAGATCAATCTCAGCCTCACCGCAATTGCATCTTTCAGAAACACAGAGTTAATTCCCTCAGAACAAAAATGGCGGAAACAGGTCTAATTTCCTCTTCAGGATCGCCGCGGA
AGCTCCGATCGATGCAGGAAATGACATTTTCAGGGATAGGGAACATGATAAAGATGCTCCCGACAGGAACGGTGTTCATGTTCCAGTTCCTGAACCCTGTCCTGACCAATAACGGGAAAT
GCCAGACGGTCAACAAGTACCTAAGCGGGGCCCTGTTGACCGTCTGCACTTTCAACTGCTGCTTCACATCCTTCACCGACAGCTACGTGGACCCCGAAGGTGGGGTCCACTACGGTATCG
CGACTTTCAAAGGCTTCTGGCCGAAGCCTTCTTCTTCTTCTTTAGGATCTGACTGGTCGGGTTACCGGATCAGGGTGGGGGACTTCTTCCACGCGTTCCTTTCGCTGATCGTGTTTGCGG
CTGTGTCGCTGTTGGATACCAATACGGTGTCGTGCTTCTTCCCGGGGTTCGAGTCCGGTGGGAAAGTGCTGCTCATGTCTCTGCCGCCGGTGATTGGACTGGTTTCGAGTGTCGTGTTTG
CGATTTTCCCTAACAATCGCCATGGAATCGGGTACCCGCCAGCGAGTGGTCAGGATGCGTCCAAGACTTCGTGATTAATGGTCAGATGAAGGTCTTAATCCAAGAAAAATAATTGATGTT
TGGATGCTGAGGAGAAGGTTTGCTTGTGTGATTATATGACTGAAGTGGAAGATATGGCTTGATTTGCTTCCCCCTTGCGACTTGTGAGAGTGTCATTTGTTTTCTTCGTTTTCGTCTATA
AACGTCGTGTAAATGGTTTATACACGTTATTGTTATCATTTTTAGCTCGAAATATATAATTTGTTTTCTTCGTTTTCGTCTATAAACGTCGTGTAAATGGTTTATACACGTTATTGTTAT
CATTTTTAGCTCGAAATATATAATTTGTTTTCTTCGTTTTCGTCTATAAACGTCGTGTAAATGGTTTATACACGTTATTGTTATCATTTTTAGCTCGAAATATGTAGTTATTCTGAAAGA
TGTAATTGTGGTGGTGTTAACAGGATATTGATATGATTTTAGCTCGAGATAGCTAGTTATTTCCGAAGGTTTCATTCAACATTCGACCGGCCAAACCAAGCCTAAAGTTCCAAGCATTGT
CTCAGTTGAAAGTCTACAATAGTATTATCATACCATCAAACTAGCAAATTTTAGGGAGGGCAGCTTGTATAACTTGTTCACTCTTGAAAGGATTTAAGAACATTCAACTCCAATCTGAGT
CCCGCCACAACCATTTTATTTCAGAGCCACCCAATACTCAGCTCAAAAACTCTTCATGGAATCTTATATGAAATCATATATATATATACTAAGAGCGACCGTTACAAACTCGAATGCGCC
GCTGGATATGGCTCCTGCAAGAATGGCTCCTGCAAGAAGGACAATCCTTCATCCCTTTCTTCTCATGGAGCTCATTGCAAGATGTGCATACCACCTGATGTGCACAAGGGAGGAACACCA
CTGACATCGCCTCTGATAAGCACATCACACATTCCCTTTCTCGCTCAACTCCTCCCTTCTCCGAGTAGTCACTAAGATCTGTGCCTAATTCCGAGACGTAATTTGTCCACCTCTCCTTCT
GTGTAGGATTGCCTTTGAGATCTGCAGCCTTGGTAGCTTGGTTTTCGTTGATCCCCTTCCGGAGAGCAGCAATCTTTGATGAGTGAACCTTCAGTCTGAGCTTGGATATCTCTTTCTCAA
GCTTCTCTATGTTATCTTTGTACCTCTGAAGACTGTTTGCTGCCTTTAATTTCATCATATCCTCTTCAGATTTTGTTGATGCCTCAATTCTGTCTCTTTCTTTTCTTGTTTCACCAGCTT
GCCGAAGCAGCTCTTCATTTGCCTTCTCTTCCTGCTGCCATCTACCCTGTGACGTTTACTGTTCTCAGTGAGAAAGGACCTAATCATAAAAGATCCTACCGCTATACTAAAACCATAAGG
CCATTGGTTTCTACATCAGGAGCCTCCTGCTGAAGATATTTTATCGAAAGATGACAAATCAAAAGACAAAAGGAACAGAAAACGTAAAATAGACCTACTTCCTAGTAAAAGTGGCACCTG
AAGGGCAATGGCAAGGCTCTTCCTTTATGAGCTTATTTTTTCCTTGATGATTAACAGGTGCATGAAACCACAGGAGACAAACCCTTCACTCAATAAAGATTGCGAAACTGTAACCTAAAT
TGTTCTCCCCATTGTATAATCTATGGCAGTTTGCATATGACTGTGCAACAATGATCGACATTTTGACTGATCATTTCTCAGGCCAGGATCTGTCACAATATTCCCGGAAGAGCTCTTCAT
CACATTTAATTTAATACCACCATCTGTTGTGCAATATGGATGCATATTTAACTCTCGATTATTCTAGCTAGACAATCATATCTCAAATGCATCCTTCTTTTATGTATCAATAAATCAAAC
TGGCAAGAATAAGCCAAATTAACACACTCAAACAGGCACCGCAGTTACATATTGCTACTGCTAAAGAAGAATAAGAAGCATACCTCTCGTTGCTCTTGTTTTCGTTTGGCAACCTCCAGA
TCATGTAGCAGGATCGAAACCTTGCGCTTTTCAGTCCCAAGATCCTCCTGGAGCAGCCCTTTCTGTTTCTCCTGTGACTGAAGTTTTATCAATGTCTTCTTCTCCCTCTTTGATGCATCC
TGACAGCTAGCAGCTGACTCTGCAGCACGTAGTTTTGCAGCTTCCATTTCCTGCCGAAGTTCAGCATTTTCCACCTCAAGCCTACGAACAGCAGAACTAGCTCTCTCCACCTGTCCACTG
GCCTTACGTAAGGCATTCTCCATTTCATTTAGCTTTTTCATGGTGTTTTCTTCTAAAGTCTGTTTCTCCTTCTTGAGCCGTTCAACTTCCTCTTTCTCTTGTCTCAGTAATTTAAGTTCA
GCCTTGTCCTTGCTTAGCCTTCTAGCAGCCTGCATAACCTTCTGATTCACCCATTCAGTCCATTCTTGAAGCTGATTTTGCAGTACTCGAACTCTAGGAAGAAGCTTAACAATCATCTCA
TCCTTCTTGTCCTGAGGAACCCACGGTATATCAATTGGCAAGGTAGCAATATTATGACATCCAACAGAATCCAAACTGGAGCTGTTTTTCGCAGGGAGGGCAAGCGAAAGCTCAGTGTCT
GCAGTTAATAGTCCTGGTATAGCACTGACTGGAGGTTTTGCAGGCAAGCCATTGGTTGGGGGTAATACCCGGGGGATGTTGGATTTAGGACAAGGAGCAGCACTAGGAGCCTCCTGACTA
GATGAGACTGGGGATGAGAGTCTGGAATTGTTTGGAAGGCTTTGATTCCCACCATCTTGAGGGGTATAAGCTCCTACTACCATACTTAATCTTATGGAGGAATTCTTGATATTAACTGAA
GTAGAATCTGAAACACACTTCAGTTTGACTAAATTACCCAAGCCACTCAATTTCCCAGACCTCAATGAACCTTTAGACCCGTAAGTTCGGTAGCCTTTCTCAAGATGTAATGATGACCTC
TGCCTGAGAATGAATTCTCTCATGGTGCTGCCAGAAACAGCCTTTCTTGTAACTGTAAACTTTTCTTCCATCACATGTGACTGAGATGGTCCTGCAATGTTGAAGAATTTATCTACAGGA
TCAAATGCAGAAGTTGATCCCTCCTTATCTGATACTTGGCCATTAAGAGCAACAGAATTCTTTGATTTTGTCACCTTGACAACCTTTGGGATATTGGTGCTTGTCTCAAGATTACGGGAA
CAAGGTACTGTGGGAACTTGCTTCAAAGGGGTAGTATCAATTGATTCAGGACCTTCAGATTTTGGTTCTATTTGTGTTTGTTGGGGAGAGCAAGAAGGCTCATGTGAGGCCCCATCAGCT
GAACCACTGATCATTGGATCACCATCCGTTGCAAAAGCATGAGAAACATTCATGTCAGAGATCAGAAGGCACCACATTGCATCCCCAGTACTGAAGACAGGCCTAGCTTCCCTCACCAAA
CAAACTAATTCAGCCAAAATATACTTCTGGAATTGCTGTAAGTCACCAAAACAATGCTCTCTAGAAGGGTCAATATCCTGACCATTTCTGAGAAACTCTAAAGTATTATCAACTATATTT
GATACTGTGTCCTTAGACCCATCATAAACACTAGACCTCAAAATTGCCTTCGTAGCCACTTGTTCAGTAAACCCACAGGCCACAATTTTTTCAATTGCACTTTTGAATATCGCATTCAAA
TTGCTCAAAACAAGCTCTTCCAATTGGGACTCTGTAATATGACCCCAATCCGGATCATGTGATTCTTCCAACGCGAGTTCCCCACTAGGCTGACTAGGCAAAACCTCACATGAACTTACA
GGACTAGATAACCCTAGGTTTAGCTTCAACTCATCTATAGAATCTTGACTGACACCACACAGGTCACAGGCAGTGGTCAGCCCATGTACTTCGGTAGCTTCGAACTTCTCAGCAGAGAAT
TGATAACTAGGACACCCGTTTTGGGGCGAAGAGGTTATCTCTTCAGCATCAACGGCGGTCGGAGGATCAGCCCGGAATTTTCTCTTGTTCCTACTCCCTTCTCCCGGGACAGATACCGAA
GATGACACTTGAGTCCCGCCGCTACTACTGGCCTTAGCAACCATTGACGCCGTTTAGCTGGATCAATACCTGATTCATCGATCGGAGACACAAGCTCGTAAAGCAACAAAACAAGAGAGA
AAAAAACAGTGACGAAGGCGCAATACAAAAGATCCAGACATGCAAGTAGTGGTGATGAAGATGGTAACGGAAGCGATGCATACCGCGGTTTGTTGAGCTGATCGTTTGAGCAGAAATCAG
AGTATCGTCACTCAGATGAATCTGCAGTATGACTCGGGAAAGAAGCAGACGAAAATAAGGAAGGTGAAATACCTAGGGAGCTCTTAATAGCTCGGGAAACCTTTTTCTTTTTAATAGGAT
TTCGAGGGTGAATCTTAACTGTTCGATATAGGTGTAGTCCTTTTTTATTCATCTAACGGTTAGAATGAAACTAGCCAATGCTAACATATTTACATTATCAGTCCTCCCAAATAAAATTTA
TTTTGAAGGAAAATTTGTAACACAAACACTAAAATTTATCCAATTAAAAAAAATCAAATTTAAATAGCTTCATATAAGATCTAATAAAATTTCAATCGTTATTTATTAATAAAAATATGT
TAAACAACATACAATTATAAATAAAAACTCACAGAAAAATTAATAGGAGATAACCGAGATATAATTAATAAGAATAACTAAATATTAATAACCATCTTATCCAAGTTAATCTTGGTGATT
AATCTTTTCGTAAATTAAACAGAAAATTTAAGAATAAGAAGTAGAAGTAGAAAACAGAAAATAAAAAGGAAAGAAGAAAAAATCAAAAGGAAGAGCTCATACATTTCACCTTCTTTGTTT
TCGTCTACTTCCTTCCCGAGACTCTCCGCAGATTGATCTGACGATCCCCTCGTTTCTGCTCAAACAATCAGCTCAACAACACACGGTATGCATCGATTCCGTTACCATCTTCATTACCAC
AGAAATTGCATGCCTGGATCTTCTGTATTGCGCCATCGTCACTGTCTTTGTCTCTTTGATTGTTTTGTTTCCTCACGAGCTTGTGTCTCCGATCGATGAATCGGGTATTGATCTCGAATA
TGTTTTTGCAGATTGAGAAACAGTCGCGTACTCTCTTTTTTTTTAATTCTATCGGCGATCGTGAATTTCGTTGATCTATTTTGATTTATCATCCAGTAAATTTATGAAATAGTTTTTTTT
TTATCATTTTCGACAGTGCTGATCAGTTTTTGTGCTGTGTAATTTCATCTTCCGCTAGTGTATGATCTGACGTTGTGGCATTCAATTCAATGCTTGGATTGAGGTAGATGAATGGCACTG
CGTGCTATGATTAACGGTCTCGTTGATTGCTAAATTGATCATTCAAGTTACTCTCTCCATTCTGCAGCTTACAATAATGTCATCAATGGTTGCTAAGGCCAGTAGTAGCTGCGGGACTCA
AGTCTCATCTTTGATATCTGTCCCAGGAAAAGGGAGTAGTTACAAAAGAAAATTCCGGGCTGATCCTCCGATTGTTGATGCTGAAAAGATAACCCCTTCACCTCAAAATGAGTGTCCTAG
TTATCAATTCTCTGCGGAGAAGTTTGAACCTACCGCAGTTCATGGATTGACCACTGCCTGTGACCTGTGTGGTGTCAGTCAAGATTATACAGATGGGTTGAAGCTAAACCTTGGGTTATC
TAGTCCTGTAAGTTCATCTGAGGTTTTGCCTAGCCAGCCTAGAGAGGAATTTGCATCGGAAGAATCACATGATCTTGATTGGAGTCATATTACAGAATCCCAATTGGAAGAGCTTGTTTT
GAGCAATTTGAATGCGATATTCAAAAGTGCAATTAAAAAAATCGTTGCATGTGGGTTTACTGAAGAAGTTGCTACAAAGGCGATAGATTTACCGAAGAAGTGGCTACGAAGGCGATTTTC
AGGTCTAGTGTTTGTGATGGTTCTAAGGACACAGTATCAAATATAGTTGATAATACTTTAGAGTTTCTCAGAAATGGTCAGGAGATTGACCCTTCTAAAGAGCATTGTTTTGGTGACTTA
CAGCAATTCCAGAAGTATATTTTGGCTGAATTAGTTCTTTTACTGAGGGACGTTAGGCCTTTCTTCAGTACCGGGGATGCAATGTGGTGCCTTCTGGTCTGTGACATGAATCTTTCTCAT
GCTTGTGCAACGGATGGTGATACAATGATCAGTGGTTCTGCTGATGGGACCTCAAATGGGGCTTTTTGCACTTCTCCACAAACACAGATGAAACCAAACGCTGAAGGTCCTGAATCAAAT
GTTTCTACCCCTTTGAAGCCAGTGCCCTCAATACCTAGTTCCCGTAATCTTCAATTTGAGACAAGCACAAATATAATCTTGAGACAAGCACCAATATCCCAAAGGTTGTCAAGGTGACAA
AATCAAAGAATTCTGTTGCTCTTAATGGCCAAGTATCAGATAAGGAGGGATCAACTTCTGCATTTGATCCTGTAGATAAATTCTTCAACATTGCAGGACAATCTCAGTCAACTGTAATGG
AAGAAAAGTTTACAGTTACAAAAAAGGTGCATTCTGGTAGCACCAAGAGAGAATTCATTCTCAGGCAGAAGACATTACATCTTGAGAAAGGCTACCGAACTTACGGGTCTAAAGGTTCAT
TGAGATCTGGGAAATTGAGTGGATTGGGTAATTTAGTTTTAGACAAGAAACTGAAGTCTATTTCAGATTCTACTTCCGTTAATATCAAGAATTCCTCCATAAGAATAAGTAAGGCCGTCG
GAGCTTATACCCCTCAAGATGGTGGGAATCAAAGCCTTCCAATCAATTCCGGACTGTCATCCTCAGTCTCGTTTAGTTTGGAGGGTCCTAGTTCTGTTCCTTTTTGTTCTAAAACCAACA
TCTTGCCGGTAAACCCAACATCCCTCCGGTATCACCACAGACCAATGGCTTGCCTGCAAAACCTCCAGTCAGTGCTATACCTGGACTATCGACTGCTGACACTGAGCTTTCGCTTTCACT
CCCTGCGAAAAGCAGCTCCAGTTTGGGTTCTGTTAGATGTCATAATATTTCTACCTTGCCAATCGATAAGCCTATGATACCGTGGGTTCCTCAGGACAAGAAGGATGAAATGATTGTTAA
GCTTCTTCCTAGAGTTCGACTACTGCAATTTCAGCTTCAAGAATGGACAGAGTGGGTAAATCAGAAGGTTATGCAGGCTGCTAGAAGGCTAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCCACTAAGACAGCCATCGCCTTCTTCTTCCTTTCTCTCTTGCTTTTCGTCCTACCTTATGCCTCTCATGCCAAAGGCCATAACGGCAACAATGGTCGGCGGGGTCGGAGAGAC
GACAACGGCCAAGGTAAGGGAAATGGACGGCCGGATCTGCCGCCATCTCCAATCCTGAAGGACTGCCCACAGTTTGAAACGGTCGCTAGGGATATTACTTGGAGTAGGGTTGCTGCTGAC
CCTACCTTGGCTCCCAAGCTACTCAGGCTGCACTATCATGATTGCTTTGTCAGG
GGTTGTGACGCGTCCATATTGCTGGATTCGACGGCTACGAATTCAGCAGAGAAAGATGCAATTCCA
AATAGATCGTTAGCAGGGTACGAGGTTATCGACGAGATTAAAGCTCGATTAGAAGCGGTTTGCCCCGCAACTGTCTCGTGTGCTGATATCCTTACATTGGCTGCGAGAGATGCTGTTTCT
TTTCAG
TTCAAAAGGGCAATGTGGCCGGTTTTCGCCGGGAGGAAGGATGGTCGAGTTTCTATGGCATCTGAAGTGCCAACGAACTTACCATCTCCATCCGGAAATATTACTACGCTCATC
CGACAATTCCGAAACAAAGGACTCGATCTTCAAGATCTCGTCGCGTTGTCAG
GCGCCCACACAATCGGGGTGAGTCGGTGCAGGGTGATATCGAGGAGGCTGTTCAACTTCACCGGAAGA
GGGGACACCGACCCGTCGATTGCGCCAGGACTCGCTAGTACCCTTAAGGCACAATGTTCCAACCCAGGTGGTGGTGCTGGAGTAACCTTGGAGATGGATCCTGGAAGCTCAACTTCCTTT
GACGCTCACTACTACCAGGCCTTGGACCAGAACCAGGGACTCTTTCAAAGCGATGCTGCACTGATGACGGACCAGCGGTCGGCTCTACTCAGCCGGATTTTGGCAAGTAATGATGATCAG
CTTTTCTTCGCCACGTTTGCTCGGTCGATGGTGAAGATGGGCGCCATTGTCGACGGTGATGGCACCGAAGGAGAGATTAGGAGGAACTGTCGCTTT
GCTAAGTAA

Retrieve as FASTA