Entry information : AtrPrx08(AmTr_v1.0_scaffold00083.30)
Entry ID 1208
Creation 2005-06-13 (Christophe Dunand)
Last sequence changes 2016-03-23 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2020-11-10 (Christophe Dunand)
Peroxidase information: AtrPrx08(AmTr_v1.0_scaffold00083.30)
Name AtrPrx08(AmTr_v1.0_scaffold00083.30)
Class Class III peroxidase     [Orthogroup: Prx004]*
Taxonomy Eukaryota Viridiplantae Streptophyta Amborellaceae Amborella
Organism Amborella trichopoda    [TaxId: 13333 ]
Cellular localisation N/D
Tissue type Flower buds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtrPrx08
start..stop
S start..stop
LcPrx03 544 0 8..329 10..332
RcPrx17 539 0 1..329 1..331
MePrx23 536 0 1..329 1..327
CclPrx35 536 0 5..328 8..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 829..1020 192 N° 3 1242..1407 166 N° 4 2020..2435 416
join(1..219,829..1020,1242..1407,2020..2435)


exon

Literature and cross-references AtrPrx08(AmTr_v1.0_scaffold00083.30)
Literature dePamphilis,C., Soltis,D., Soltis,P., Farmerie,W., Ma,H., Tanksley,S., Leebens-Mack,J., Field,D., Buzgo,M., Kim,S., Ilut,D., Landherr,L., Hu,Y., Wall,K., Albert,V., Carlson,J., Doyle,J., Frohlich,M., Miller,W., Oppenheimer,D. and Theissen,G.
unpublished (2002)
EST ref. GenBank:   CD483448.2 [3' end]
Cluster/Prediction ref. Genebank:   18430639
Protein sequence: AtrPrx08(AmTr_v1.0_scaffold00083.30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (307)
PWM (Da):   %s   36009.4 (33611.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.47 (9.60) Peptide Signal:   %s   cut: 24 range:24-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGATLKAFVILSVMLWGICGCFGHGGYLYPQFYDKSCPKAPEIVKSVVAKAVAREARMAASLLRLHFHDCFVKGCDASLLLDSSGSIISEKRSNANRNSARGFEVIDEIKSALEKECPLTVSCADILALAARDSTVLAGGPHWEVPLGRRDSRGASLSGSNRNIPAPNSTIQTLITKFKLQGLDTVDLVALSGSHTIGQSRCTSFRQRLYNQTGNGRPDLTLDQGYAAQLRTRCPRSGGDSNLFPLDFVSPTVFDNWYFKNIVASKGLLNSDQVLFTRSEKTMEIVELYAKNNQLFIQHFANSMVKMGNISPLTGSRGEVRKNCRRINSS

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. From early flower buds
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGCTACTCTTAAAGCTTTTGTGATCTTATCGGTGATGTTGTGGGGGATATGTGGGTGTTTTGGTCATGGTGGGTACTTGTATCCGCAGTTCTACGATAAGTCGTGCCCGAAAGCA
CCGGAGATTGTGAAATCGGTTGTAGCAAAGGCAGTTGCCAGAGAAGCTAGGATGGCTGCTTCATTACTCAGGCTTCATTTCCACGACTGCTTTGTCAAG
GTCACATTTCCACTCCACAAC
CCTGTCTCTCTACTGGTGTGTGTGTGTGTGTGAGATGAGAGAGAGAGAGAGAGACGTTTGAGGTTCGAAATTTTGTTATCAATGTTAGCGAGAGTGAACGATGGCTTTTGAGGTCGAAAA
TTTGTTTTCCATGCAAGAGAGAGGGGAAAGGCACTGTGTCTGGAAGGTTTAAAGTTGAGAAAGAGAGACTGTTCGTACATTTCGAGAAGTGCAAGTTTTAGAGTAATTGGGCTCCTGGAT
TGGCTCACTTGAAAAGTTTTATATTCTGAGGGTATATTTGTCATTTTTATCTCTCGTACAAAAATTTTGTAATTTTTTGGTTTAGAATTATGGTTCGAAAAAATGGTCGAGTCAATTCTG
AATCGACTCCTAAAACTTGTCAATTTCCCAATTTTTTTATTTTTTTACAAACCAAAAGCCTTTCATGACGATCAAGAAACCCCTCATTTTTAAATGACCATTTTGTCCTCAACACAGACC
TTGAACAAGTAATACCCAAATTGCCGTTTAATCCATAATGGACTATTTTGCCGTTCAATATGGATCTTTCAGCGTGAACCAAATATGCTGAGCCATGGACCTTTACAGGGTTGCGACGCT
TCTCTCTTACTAGACAGCAGCGGGAGCATCATTAGCGAGAAGCGGTCGAATGCTAACCGTAACTCAGCTCGTGGGTTCGAAGTGATCGATGAAATCAAGTCAGCATTAGAGAAAGAGTGC
CCTCTGACTGTTTCTTGTGCTGATATTCTCGCCCTTGCAGCCCGTGACTCCACTGTTCTG
GTAATTCTCGTGCCTTAACTCAAATTCATGCCTTCTTTTTCACACTGTAGAGAAAATCGA
CTTGGGAATTCGGCCCTTGCTGGAGCAGATCCCTGAGTCAAGTACAAGGCTGATAAAAACTAAACAAATTAAAAAAAATGATAAAACAATTCAAAATTAAAAAGGAAAATGTATTAGTTG
ATTTATTGATATGATATATTTTTATCTTTTCTTACTTGAAGGCTGGAGGGCCTCACTGGGAAGTTCCATTGGGGAGGAGGGACTCAAGGGGTGCTAGCTTGAGTGGATCAAACCGCAATA
TCCCTGCACCAAACTCCACCATCCAAACACTCATCACCAAATTCAAGCTCCAGGGTCTCGACACAGTCGACTTGGTCGCACTCTCCG
GTACATTTACATTCCTACCTTCTTGTTTTTGAT
GTTGTTGTGGTTAGGAAAAAAATTTACAGATAAGTTCATTTTATTTTTTATATCTAAGAATAATCCTATATATATATATATATATATATATATATATATATATATATCAAGTCCACTTAT
TGAAAATATAAAAGTATATGTTAATTTTATTTCTTTTTCTATAATTCGGACTAACGTCAATTTTGGTTCATTCACATTTTCACCATTATAGACCTACAAAATATTATAAATAATTTAAAT
ACATATAAAGTTATCAAATTACCTCTATACTATTCAAGGATAGCTCGGTAATTTTATTTATTTTAAATAGTTTATAAATAATTTTTATGGATATTTGATAGTGAAAATACATATATAACA
AATTTGAACTTAATCTGATACATATCAAAAGAGATAAAACTAGAATATATTTTATGTTCCCAAAATAGGAACTTAATCGACTACTTTCAAATATCAAAAATAAAACCAGGGTATCTATAA
ATTTTCCTAATTATTATTGAATGTTGCTTGGGACCTCGTGGGGGTCAACCTCTAGATGATGCATCGTGGCTCATGATATGAAACTATGTTGATACACAGGAAGCCACACAATTGGACAAT
CTCGATGCACTAGCTTCAGGCAAAGGCTCTACAACCAGACAGGAAATGGCCGCCCAGACCTAACCCTCGACCAGGGCTATGCTGCACAGCTTCGAACACGTTGCCCTCGATCCGGTGGAG
ACAGCAACCTCTTCCCTCTTGACTTCGTGAGCCCTACAGTGTTCGACAATTGGTACTTCAAGAACATTGTTGCCTCCAAAGGGTTGCTCAATTCTGACCAAGTGCTCTTCACCAGAAGTG
AGAAAACAATGGAGATTGTGGAGTTGTATGCTAAGAACAACCAACTTTTCATCCAACATTTTGCAAATTCCATGGTTAAGATGGGGAACATTAGCCCCCTCACTGGTTCAAGAGGAGAGG
TAAGGAAGAACTGTAGAAGAATCAACTCTTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGCTACTCTTAAAGCTTTTGTGATCTTATCGGTGATGTTGTGGGGGATATGTGGGTGTTTTGGTCATGGTGGGTACTTGTATCCGCAGTTCTACGATAAGTCGTGCCCGAAAGCA
CCGGAGATTGTGAAATCGGTTGTAGCAAAGGCAGTTGCCAGAGAAGCTAGGATGGCTGCTTCATTACTCAGGCTTCATTTCCACGACTGCTTTGTCAAG
GGTTGCGACGCTTCTCTCTTA
CTAGACAGCAGCGGGAGCATCATTAGCGAGAAGCGGTCGAATGCTAACCGTAACTCAGCTCGTGGGTTCGAAGTGATCGATGAAATCAAGTCAGCATTAGAGAAAGAGTGCCCTCTGACT
GTTTCTTGTGCTGATATTCTCGCCCTTGCAGCCCGTGACTCCACTGTTCTG
GCTGGAGGGCCTCACTGGGAAGTTCCATTGGGGAGGAGGGACTCAAGGGGTGCTAGCTTGAGTGGATCA
AACCGCAATATCCCTGCACCAAACTCCACCATCCAAACACTCATCACCAAATTCAAGCTCCAGGGTCTCGACACAGTCGACTTGGTCGCACTCTCCG
GAAGCCACACAATTGGACAATCT
CGATGCACTAGCTTCAGGCAAAGGCTCTACAACCAGACAGGAAATGGCCGCCCAGACCTAACCCTCGACCAGGGCTATGCTGCACAGCTTCGAACACGTTGCCCTCGATCCGGTGGAGAC
AGCAACCTCTTCCCTCTTGACTTCGTGAGCCCTACAGTGTTCGACAATTGGTACTTCAAGAACATTGTTGCCTCCAAAGGGTTGCTCAATTCTGACCAAGTGCTCTTCACCAGAAGTGAG
AAAACAATGGAGATTGTGGAGTTGTATGCTAAGAACAACCAACTTTTCATCCAACATTTTGCAAATTCCATGGTTAAGATGGGGAACATTAGCCCCCTCACTGGTTCAAGAGGAGAGGTA
AGGAAGAACTGTAGAAGAATCAACTCTTCTTAG

Retrieve as FASTA