Entry information : LuPrx133(Lus10025255|PACid:23157441)
Entry ID 12085
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx133(Lus10025255|PACid:23157441)
Name LuPrx133(Lus10025255|PACid:23157441)
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx133
start..stop
S start..stop
VvPrx13 469 3e-168 4..329 2..318
StPrx33 466 6e-167 3..329 2..319
StPrx34 464 3e-166 17..329 8..319
RcPrx56 463 7e-166 17..329 9..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 207462..207698 237 N° 2 207182..207376 195 N° 3 205753..206310 558  
complement(join(205753..206310,207182..207376,207462..207698))


exon

Literature and cross-references LuPrx133(Lus10025255|PACid:23157441)
DNA ref. Phytozome 12:   scaffold339 (207698..205753)
Protein sequence: LuPrx133(Lus10025255|PACid:23157441)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (305)
PWM (Da):   %s   35698.88 (32968.6) Transmb domain:   %s   i13-35o
PI (pH):   %s   9.68 (9.50) Peptide Signal:   %s   cut: 25 range:25-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSRSMQQITMMMIFATSLVLAFNVASSSASLSPYYYHKVCPKALPTIRRVVEAAVQRERRMGASLLRLHFHDCFVQGCDGSILLDATPTIDSEKTALPNNNSARGFEVIDQIKAAVDKACGRPVVSCADILAVAARDSVVALGGPSWEVELGRRDSTTASRTTANNDIPSPFMDLPALRSSFKKQGLNERDLVALSGGHTIGFAQCQFFRNRIFNETSASSINPKFARERRSNCFANSGDTNLASLDSSAASFDISYFKNLVAKKGLLHSDQALLAGGSTNSLVSTYSSNGRSFWYDFANSMVKMGNIKPLTGNRGQIRVNCRMVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTCTTCACGTAGCATGCAGCAGATTACCATGATGATGATCTTCGCCACGTCACTTGTTCTGGCCTTCAATGTTGCTTCCTCGTCAGCTTCACTGTCTCCATACTACTACCAC
AAAGTATGCCCAAAAGCATTGCCAACTATCCGCCGGGTCGTCGAGGCCGCTGTTCAACGCGAGCGTCGTATGGGCGCGTCTCTGTTGCGTCTCCATTTCCACGACTGCTTCGTCCAA
GTA
CGTACTGTCGATTCTGCGGAAGCTTTTGTTATACGTACGCACGTAGGATTTATATATATTGATCTGATTATCATGCATGCAGGGGTGTGATGGGTCGATTCTTTTGGATGCGACGCCGAC
AATCGACAGCGAGAAGACTGCTCTCCCTAACAACAACTCCGCTCGAGGGTTTGAGGTTATCGACCAGATCAAGGCCGCAGTTGACAAGGCCTGCGGCAGGCCTGTCGTCTCCTGCGCTGA
TATCTTGGCTGTTGCTGCTCGTGACTCTGTTGTTGCG
GTAAGAGTGTTATTACTTAACTATGTCTTATCAATAAAACAGAGATATATAAACAGTGTCGTTAGGTTTGGACCAGATTATCT
AGCCCAATTTTGAAAAAGTCGAATCCTTAGTCGAGCCGGTCGGTTATGTACGATAAAAAACTTCTCTGAAAAACCTACAAAACTGTTTGAACCGTTCCAGTCATTTATCCTGTTCATTAA
CGAGAGAGAAAATTTGTAAGTGAATAGTAGAAAATTTATAACAATTTTTTTTAATAATTTGATTTATTGGGATGCAACGTTTGTTGACACGACATCAATATTTAGACCAAACTGTCATGT
GTTTGAATCTCCACAACTCCTAATATTAACAGTTGATTTAAGCATAAGGTATGATGAGTCTATGCAAACTTCAAACCATGAATTGGCTTTTGTTTGAGAGGCGTATATATAAGAGAATAA
TATAAAATCTATAATTAATTCTATTCTAATAATTCAAATTATTAAAATGCAACATAACCGGGTATAATCTATGCATATAAAACATGAGTTGAATAATTATATGAATGCATGTTGAAAAAT
ATAATATGTTTACTAATTTTGTTGGTTATATTGCATTCTGAATTAATGTTTATAAATATGGTAGTTATATAGTGTTTTGACTTTTGTATAGCAATAGTAACGTGGACAATTCTTTGAACA
GTGTTTTTTAGGTTCAATTCCGGTTACATTTAACTCTTAAACTCAATCTTTCTCATTCAATCCTACATTAGGTTCGGTTCTTGCACAATCACGATTTGAGTTTTTGAAACATGGGTTTAA
TTGTTTTATAAGTAGAGATTTTATTGCAACGAAACCAAAAGTTCATGGGTTTAATATTATACATGCAGCTGGGAGGCCCAAGCTGGGAAGTAGAGCTGGGACGAAGGGACTCAACAACTG
CTAGTAGAACAACAGCAAACAACGACATCCCATCACCATTCATGGACCTTCCCGCACTCCGAAGCTCCTTCAAAAAGCAAGGCCTCAACGAAAGGGACCTCGTAGCACTCTCCGGGGGCC
ACACAATCGGGTTCGCTCAGTGCCAGTTCTTCAGGAACCGGATCTTCAACGAGACATCCGCAAGCAGTATCAACCCTAAGTTCGCCAGAGAGCGCCGATCAAACTGTTTCGCCAACTCCG
GAGACACCAACCTCGCTTCCTTGGACAGCTCAGCAGCCAGCTTCGACATTTCGTACTTCAAGAACTTGGTCGCCAAGAAAGGGTTGCTTCACTCCGACCAAGCCCTCCTCGCTGGCGGGT
CCACTAACTCGCTGGTCAGCACTTACAGCTCGAACGGAAGGAGTTTCTGGTACGATTTCGCCAACTCGATGGTTAAGATGGGGAACATTAAACCGTTGACTGGGAACCGTGGTCAGATTC
GAGTCAACTGCAGGATGGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTCTTCACGTAGCATGCAGCAGATTACCATGATGATGATCTTCGCCACGTCACTTGTTCTGGCCTTCAATGTTGCTTCCTCGTCAGCTTCACTGTCTCCATACTACTACCAC
AAAGTATGCCCAAAAGCATTGCCAACTATCCGCCGGGTCGTCGAGGCCGCTGTTCAACGCGAGCGTCGTATGGGCGCGTCTCTGTTGCGTCTCCATTTCCACGACTGCTTCGTCCAA
GGG
TGTGATGGGTCGATTCTTTTGGATGCGACGCCGACAATCGACAGCGAGAAGACTGCTCTCCCTAACAACAACTCCGCTCGAGGGTTTGAGGTTATCGACCAGATCAAGGCCGCAGTTGAC
AAGGCCTGCGGCAGGCCTGTCGTCTCCTGCGCTGATATCTTGGCTGTTGCTGCTCGTGACTCTGTTGTTGCG
CTGGGAGGCCCAAGCTGGGAAGTAGAGCTGGGACGAAGGGACTCAACA
ACTGCTAGTAGAACAACAGCAAACAACGACATCCCATCACCATTCATGGACCTTCCCGCACTCCGAAGCTCCTTCAAAAAGCAAGGCCTCAACGAAAGGGACCTCGTAGCACTCTCCGGG
GGCCACACAATCGGGTTCGCTCAGTGCCAGTTCTTCAGGAACCGGATCTTCAACGAGACATCCGCAAGCAGTATCAACCCTAAGTTCGCCAGAGAGCGCCGATCAAACTGTTTCGCCAAC
TCCGGAGACACCAACCTCGCTTCCTTGGACAGCTCAGCAGCCAGCTTCGACATTTCGTACTTCAAGAACTTGGTCGCCAAGAAAGGGTTGCTTCACTCCGACCAAGCCCTCCTCGCTGGC
GGGTCCACTAACTCGCTGGTCAGCACTTACAGCTCGAACGGAAGGAGTTTCTGGTACGATTTCGCCAACTCGATGGTTAAGATGGGGAACATTAAACCGTTGACTGGGAACCGTGGTCAG
ATTCGAGTCAACTGCAGGATGGTCAACTAA

Retrieve as FASTA