Entry information : LuPrx134(Lus10025256|PACid:23157356)
Entry ID 12086
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx134(Lus10025256|PACid:23157356)
Name LuPrx134(Lus10025256|PACid:23157356)
Class Class III peroxidase     [Orthogroup: Prx010]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx134
start..stop
S start..stop
RcPrx52 380 5e-133 33..329 24..317
MePrx20 370 5e-129 33..329 36..329
CclPrx113 366 1e-127 33..329 26..318
GrPrx38 361 2e-125 32..329 30..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 213027..213260 234 N° 2 212623..212817 195 N° 3 212357..212522 166 N° 4 211639..212033 395
complement(join(211639..212033,212357..212522,212623..212817,213027..213260))


exon

Literature and cross-references LuPrx134(Lus10025256|PACid:23157356)
DNA ref. Phytozome 12:   scaffold339 (213260..211639)
Protein sequence: LuPrx134(Lus10025256|PACid:23157356)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (303)
PWM (Da):   %s   35029.6 (32204.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.6 (5.07) Peptide Signal:   %s   cut: 27 range:27-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARPSLINHSFATLLLLASFLAVGTSISLVLDLSLNCYDQTCPLATSKIKEIVNEAVQTERRMGASLLRLHFHDCFVNGCDGSVLLDDVAPSFVGEKTAPPNDNSLRGFDVIDKIKATLESMCPGVVSCSDILTVAARDAVVALGGPSWQVLLGRKDSTTANFTGALTDLPSPFLDFTNLAAAFALKGFTSQEMVTLSGAHTAGKARCALYRDRAHTELNIDSGYATFLQSVCPLSGGDDNLAPLDNSTTNDVFDVGYYRSLANQKGLLHSDQALLPSVANTQVNTYNTILVGSLTFFSDFANAMVKMGNLTGPAGNVGQIRTNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTCCAAGTCTTATTAACCACAGTTTTGCCACACTACTTCTCTTGGCTAGTTTCCTTGCTGTAGGGACCTCGATCTCTTTGGTGCTCGACTTATCTCTCAATTGCTACGATCAG
ACGTGCCCTCTCGCCACCTCCAAGATCAAAGAGATCGTCAACGAAGCAGTCCAGACCGAGAGGCGCATGGGGGCCTCTCTCCTTCGTCTTCACTTTCACGATTGCTTTGTCAAT
GTAAGT
AAACTAAACTACGTAGTAATAAATAATATAAGACCAATAATAGTGAATTGAGCAGAGACTTTGATTCACAAAAGGGTTTAGTGTTTTATTCCTGGACGACTGGACCGATAGTCCCGAATC
TTATTTGTCGAAACTATACAACCCTCAGAGTCTTCATGAGTTATTGTCAGGTTAAATGGATGTACTAAGTCTTGGTGGTGCAGGGATGTGATGGATCGGTACTGCTAGACGACGTGGCAC
CAAGTTTCGTAGGAGAGAAGACTGCGCCGCCAAACGACAACTCCCTGAGAGGGTTCGATGTGATCGACAAGATCAAAGCGACGTTGGAAAGTATGTGTCCAGGAGTTGTGTCCTGTTCTG
ATATCTTGACGGTGGCTGCCCGAGATGCCGTTGTGGCT
GTAAGTTATCAGTTATATTTAATTCCTTTTTTAATTGATTACTCGTAATAAATGTAACAAATTAAATGACAATGTGGAGGGT
GTTAAATGAATTGTGTAGCTTGGAGGACCAAGTTGGCAAGTTCTACTGGGACGAAAAGACTCCACCACCGCCAATTTCACCGGCGCACTCACAGACCTCCCTTCTCCGTTTCTAGATTTC
ACCAACCTCGCCGCCGCCTTTGCCCTCAAGGGCTTTACCTCTCAGGAAATGGTCACTCTCTCTG
GTTCGTGTATATACACCATCTTTATACATGATTTTCTCGTAATAATTTCTTGTGCT
AGTGGATTAACGAAAGGGCAGGATTCAAGGTTAGTGTGGTCATTTCACTTGTTGTTTAAAATCAATTTTTAGAAAAAAAAATTAAACAATTGATTTGTTAAAAAATTTCATTCCCCTTAA
AATTCAATTACAGTGGAAAATCCACTCCCGTCGCAATTGAATTAGCATAGCGAAAAATGATGCTTTATTATAAATATACCATATTACGTTGTAATTTAGCTTCGACGAAAGTTCGTTCCA
CTAATATGAGTACGCATGTGCATGCAGGAGCACATACGGCAGGGAAAGCAAGGTGCGCGCTGTACCGGGACCGCGCTCACACCGAGTTGAACATCGATTCCGGCTATGCAACTTTCCTCC
AGTCAGTCTGTCCGCTGTCTGGAGGCGACGATAACCTCGCCCCTCTCGACAACTCAACCACCAACGACGTGTTCGATGTGGGTTACTATCGGAGCTTGGCGAACCAAAAGGGACTCCTCC
ACTCAGACCAGGCGCTCCTCCCCTCCGTTGCCAATACGCAGGTCAACACCTACAACACTATATTGGTTGGGTCGCTGACTTTCTTCTCGGACTTCGCTAATGCGATGGTAAAGATGGGGA
ATCTTACCGGTCCAGCTGGCAACGTTGGTCAGATCAGAACCAACTGCAGGAGAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTCCAAGTCTTATTAACCACAGTTTTGCCACACTACTTCTCTTGGCTAGTTTCCTTGCTGTAGGGACCTCGATCTCTTTGGTGCTCGACTTATCTCTCAATTGCTACGATCAG
ACGTGCCCTCTCGCCACCTCCAAGATCAAAGAGATCGTCAACGAAGCAGTCCAGACCGAGAGGCGCATGGGGGCCTCTCTCCTTCGTCTTCACTTTCACGATTGCTTTGTCAAT
GGATGT
GATGGATCGGTACTGCTAGACGACGTGGCACCAAGTTTCGTAGGAGAGAAGACTGCGCCGCCAAACGACAACTCCCTGAGAGGGTTCGATGTGATCGACAAGATCAAAGCGACGTTGGAA
AGTATGTGTCCAGGAGTTGTGTCCTGTTCTGATATCTTGACGGTGGCTGCCCGAGATGCCGTTGTGGCT
CTTGGAGGACCAAGTTGGCAAGTTCTACTGGGACGAAAAGACTCCACCACC
GCCAATTTCACCGGCGCACTCACAGACCTCCCTTCTCCGTTTCTAGATTTCACCAACCTCGCCGCCGCCTTTGCCCTCAAGGGCTTTACCTCTCAGGAAATGGTCACTCTCTCTG
GAGCA
CATACGGCAGGGAAAGCAAGGTGCGCGCTGTACCGGGACCGCGCTCACACCGAGTTGAACATCGATTCCGGCTATGCAACTTTCCTCCAGTCAGTCTGTCCGCTGTCTGGAGGCGACGAT
AACCTCGCCCCTCTCGACAACTCAACCACCAACGACGTGTTCGATGTGGGTTACTATCGGAGCTTGGCGAACCAAAAGGGACTCCTCCACTCAGACCAGGCGCTCCTCCCCTCCGTTGCC
AATACGCAGGTCAACACCTACAACACTATATTGGTTGGGTCGCTGACTTTCTTCTCGGACTTCGCTAATGCGATGGTAAAGATGGGGAATCTTACCGGTCCAGCTGGCAACGTTGGTCAG
ATCAGAACCAACTGCAGGAGAGTCAACTAA

Retrieve as FASTA