Entry information : LuPrx14 (Lus10001442|PACid:23170694)
Entry ID 12090
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-09-29 (Christophe Dunand)
Peroxidase information: LuPrx14 (Lus10001442|PACid:23170694)
Name (synonym) LuPrx14 (Lus10001442|PACid:23170694)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type Seed coats
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx14
start..stop
S start..stop
RcPrx06 523 0 28..332 25..329
MePrx133 523 0 27..332 19..324
PtPrx51 514 0 28..332 24..328
MePrx03 510 0 29..330 25..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 78784..79011 228 N° 2 78472..78669 198 N° 3 77642..78214 573  
complement(join(77642..78214,78472..78669,78784..79011))


exon

Literature and cross-references LuPrx14 (Lus10001442|PACid:23170694)
DNA ref. Phytozome 12:   scaffold1135 (79011..77642)
EST ref. GenBank:   JG089816.1 [3' end]
Protein sequence: LuPrx14 (Lus10001442|PACid:23170694)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333
PWM (Da):   %s   36587.77 Transmb domain:   %s   i7-29o
PI (pH):   %s   10.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVHHHHPLALILLVIFLLPANLIVPSASQLSPDFYKNSCPNVESIVRSAVQAKFRQTFVTAPATLRLFFHDCFVRGCDASVLLASPTNNAEKDHPDDISLAGDGFDTVIKAKAAVDRVPTCRNKVSCADILALATREVVSLTGGPFYRVELGRRDGRVSTKASVQRQLPHANFNLNQLNQMFAARSLSQTDMIALSGAHTLGFSHCNQFSNRIYGFSSRNRIDPTLNFQYALQLRQMCPARVDPRIAINMDPTTPQRFDNAYYRNLQQGKGLFSSDQVLFTDPRSRPTVNRFAASNAAFGQAFAAAVTKLGRVGVLTGSRGEIRRDCTRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTCATCACCATCATCCTCTTGCCTTGATTCTCCTCGTAATATTCCTTCTCCCTGCAAATCTCATTGTTCCTTCAGCATCACAGCTCTCCCCGGACTTCTACAAGAATAGCTGC
CCAAATGTGGAGTCCATTGTCCGCTCAGCAGTCCAAGCCAAGTTCCGGCAGACCTTCGTCACTGCTCCCGCCACCCTCCGTCTCTTCTTCCACGACTGCTTCGTCCGG
GTACGTACTCCA
ACAGCTCGTTCATTTTTTCAAATTCTTAGGATATAATGATTCTTTACACGGTAACAGAATTATGTTCATTAATATCAATGGTGTTTGATTATATTTCAATAGGGATGTGATGCTTCTGTG
CTCCTTGCATCCCCCACCAACAATGCTGAGAAGGATCACCCTGACGACATCTCGCTAGCCGGCGATGGATTCGACACGGTCATCAAGGCCAAGGCCGCTGTTGACCGCGTCCCCACTTGC
CGCAACAAGGTCTCTTGCGCCGATATCCTTGCTCTCGCTACCCGCGAAGTTGTCTCCCTG
GTACTCCTCTACTCCGAAACACTTTGTAGTTACGGTTGCATACCACATAAATAAGTCGGT
TTCGGTTAAAATAGGTATATAATAATTAATATATTTAGTTGGTGATTCGGATTTGATCATTAACCGTAACCGAATTGCCGTACCTAAACTCTACCTCAAAACTCCTCTCTAAACTTGAGA
ACGAGCCTCGAACAAGCACTGATCTGCTCGCCAGCGGCTTATCTCCAAACTAAAAACTGATGCTTTTATACTTGCAGACAGGGGGACCGTTCTACAGAGTGGAGCTAGGCAGAAGGGACG
GAAGAGTATCAACAAAAGCAAGCGTCCAACGTCAGCTCCCACACGCAAACTTCAACTTGAATCAGCTCAACCAAATGTTCGCCGCACGTTCACTCTCCCAGACGGACATGATCGCACTCT
CCGGAGCACACACTTTAGGCTTCTCCCACTGTAACCAGTTCTCGAACCGGATATACGGGTTCAGTTCGAGGAACCGGATCGACCCGACCCTCAACTTCCAGTACGCATTGCAGCTCAGGC
AGATGTGCCCCGCTCGAGTCGACCCGAGAATCGCGATCAACATGGACCCCACGACTCCTCAGCGGTTCGACAACGCCTACTACCGCAACTTGCAACAGGGGAAGGGTTTGTTCAGCTCGG
ACCAAGTGCTTTTCACTGACCCACGGTCGAGACCGACTGTGAACCGGTTTGCAGCCAGCAATGCTGCTTTCGGACAGGCGTTTGCTGCCGCTGTCACGAAGCTGGGACGCGTTGGCGTGC
TCACCGGATCTCGTGGCGAGATCCGGAGAGACTGCACTCGAGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTCATCACCATCATCCTCTTGCCTTGATTCTCCTCGTAATATTCCTTCTCCCTGCAAATCTCATTGTTCCTTCAGCATCACAGCTCTCCCCGGACTTCTACAAGAATAGCTGC
CCAAATGTGGAGTCCATTGTCCGCTCAGCAGTCCAAGCCAAGTTCCGGCAGACCTTCGTCACTGCTCCCGCCACCCTCCGTCTCTTCTTCCACGACTGCTTCGTCCGG
GGATGTGATGCT
TCTGTGCTCCTTGCATCCCCCACCAACAATGCTGAGAAGGATCACCCTGACGACATCTCGCTAGCCGGCGATGGATTCGACACGGTCATCAAGGCCAAGGCCGCTGTTGACCGCGTCCCC
ACTTGCCGCAACAAGGTCTCTTGCGCCGATATCCTTGCTCTCGCTACCCGCGAAGTTGTCTCCCTG
ACAGGGGGACCGTTCTACAGAGTGGAGCTAGGCAGAAGGGACGGAAGAGTATCA
ACAAAAGCAAGCGTCCAACGTCAGCTCCCACACGCAAACTTCAACTTGAATCAGCTCAACCAAATGTTCGCCGCACGTTCACTCTCCCAGACGGACATGATCGCACTCTCCGGAGCACAC
ACTTTAGGCTTCTCCCACTGTAACCAGTTCTCGAACCGGATATACGGGTTCAGTTCGAGGAACCGGATCGACCCGACCCTCAACTTCCAGTACGCATTGCAGCTCAGGCAGATGTGCCCC
GCTCGAGTCGACCCGAGAATCGCGATCAACATGGACCCCACGACTCCTCAGCGGTTCGACAACGCCTACTACCGCAACTTGCAACAGGGGAAGGGTTTGTTCAGCTCGGACCAAGTGCTT
TTCACTGACCCACGGTCGAGACCGACTGTGAACCGGTTTGCAGCCAGCAATGCTGCTTTCGGACAGGCGTTTGCTGCCGCTGTCACGAAGCTGGGACGCGTTGGCGTGCTCACCGGATCT
CGTGGCGAGATCCGGAGAGACTGCACTCGAGTTAATTAA

Retrieve as FASTA