Entry information : LuPrx145 (Lus10027164|PACid:23145459)
Entry ID 12093
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-18 (Christophe Dunand)
Peroxidase information: LuPrx145 (Lus10027164|PACid:23145459)
Name (synonym) LuPrx145 (Lus10027164|PACid:23145459)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx145
start..stop
S start..stop
LuPrx203 639 0 1..324 1..323
LuPrx84 558 0 1..324 1..325
LuPrx174 553 0 1..324 1..325
MePrx24 488 9e-176 6..324 7..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 72187..72393 207 N° 2 71912..72103 192 N° 3 71658..71820 163 N° 4 71085..71497 413
complement(join(71085..71497,71658..71820,71912..72103,72187..72393))


exon

Literature and cross-references LuPrx145 (Lus10027164|PACid:23145459)
Literature Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
DNA ref. Phytozome 12:   scaffold472 (72393..71085)
Protein sequence: LuPrx145 (Lus10027164|PACid:23145459)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (302)
PWM (Da):   %s   35417.81 (32823.5)  
PI (pH):   %s   8.33 (8.57) Peptide Signal:   %s   cut: 23 range:23-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKSHLCIFTLLLAIFFATTEAQLQMNFYSQSCPKAEQIVLDYVKKHISNAPTLASPILRMHFHDCFVRGCDASVMINSTSNNTAEKAAAPNLTLRGFNFLDGIKSLLEKECPGVVSCADILALTARDSVAFIGGPTWRVPTGRRDGRISNSSEALNAIPPPTSNFTTLQRLFGNVGLDLKDLVLLSAAHTIGISHCNSFSARLYNFTGRGNGQDPALDSEYATKLKMKCLNTTDNVTIVEMDPGSFRTFDLSYFQLVQKRRGLFQSDAALSTSSTTMSLINQFGSGTVQNFFTEFALSMEKMGRINVKTGSAGEIRRNCAVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Experimental evidency of cell wall localization
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAATCGCATCTCTGTATCTTTACTCTTCTTTTGGCAATCTTCTTTGCAACAACTGAAGCTCAGCTTCAGATGAACTTCTACTCACAGAGTTGCCCCAAAGCAGAGCAGATCGTC
CTCGATTATGTCAAGAAACACATCTCCAATGCTCCCACCCTCGCCTCCCCGATCCTCCGCATGCATTTCCACGACTGCTTCGTCAGG
GTACGTACGATCGAAGTTCACCAACGTACCACT
AGGTCATCCTTACTTGATCGAGCTTGATGATGATTTTATTTTGGATGCAGGGGTGTGATGCTTCTGTGATGATCAACTCGACTTCTAATAATACCGCGGAGAAAGCTGCGGCTCCGAATT
TGACTCTAAGAGGGTTCAACTTCCTCGACGGTATCAAGAGCTTGCTCGAGAAAGAGTGCCCTGGCGTCGTCTCTTGTGCTGATATTCTCGCTCTTACGGCTAGAGACTCTGTTGCTTTTA
TT
GTAAGCTTTTTTTACTTTTTGAAAAATCAGTTCATCTCAATAATTCGATTTTTTCTCAGATGGTTGATGAAATTATTCTTCTTTTTTTAAGGGTGGACCCACTTGGAGAGTTCCGACG
GGGAGAAGGGATGGGAGGATCTCGAACTCGTCGGAGGCGCTTAACGCGATCCCTCCTCCGACTAGCAACTTCACCACTCTCCAGAGGTTGTTCGGGAATGTTGGTCTCGATTTGAAGGAC
TTGGTCCTCCTCTCCG
GTAATTAAATGTTAGATTTATTTATATATTAATTGTTATTAGATAATTATCGGCTTGTTAGCCGAGTTATGACGTTGGATATAATAAGATTCATTTTAAACCAT
CGTGACGTTAATAATTAACACCTTTTTATTTTATGTTAAACCTTATTACTATATAGCGGCCCACACAATCGGGATATCTCACTGCAACTCCTTCTCTGCTCGGCTCTACAACTTCACGGG
CCGGGGCAACGGGCAGGACCCGGCCCTAGACAGTGAGTACGCGACCAAGTTGAAAATGAAGTGTCTAAACACGACCGACAACGTGACCATTGTGGAGATGGACCCGGGGAGTTTCCGGAC
GTTCGACCTAAGCTACTTCCAGCTGGTCCAAAAGAGGAGAGGGTTGTTCCAATCCGACGCCGCATTGAGCACGAGTAGTACCACGATGTCGCTCATCAACCAGTTCGGTTCGGGTACCGT
TCAGAACTTCTTCACCGAGTTTGCTCTGTCTATGGAGAAGATGGGCCGGATCAATGTGAAGACCGGGTCGGCTGGTGAGATCCGGAGGAATTGTGCCGTGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAATCGCATCTCTGTATCTTTACTCTTCTTTTGGCAATCTTCTTTGCAACAACTGAAGCTCAGCTTCAGATGAACTTCTACTCACAGAGTTGCCCCAAAGCAGAGCAGATCGTC
CTCGATTATGTCAAGAAACACATCTCCAATGCTCCCACCCTCGCCTCCCCGATCCTCCGCATGCATTTCCACGACTGCTTCGTCAGG
GGGTGTGATGCTTCTGTGATGATCAACTCGACT
TCTAATAATACCGCGGAGAAAGCTGCGGCTCCGAATTTGACTCTAAGAGGGTTCAACTTCCTCGACGGTATCAAGAGCTTGCTCGAGAAAGAGTGCCCTGGCGTCGTCTCTTGTGCTGAT
ATTCTCGCTCTTACGGCTAGAGACTCTGTTGCTTTTATT
GGTGGACCCACTTGGAGAGTTCCGACGGGGAGAAGGGATGGGAGGATCTCGAACTCGTCGGAGGCGCTTAACGCGATCCCT
CCTCCGACTAGCAACTTCACCACTCTCCAGAGGTTGTTCGGGAATGTTGGTCTCGATTTGAAGGACTTGGTCCTCCTCTCCG
CGGCCCACACAATCGGGATATCTCACTGCAACTCCTTC
TCTGCTCGGCTCTACAACTTCACGGGCCGGGGCAACGGGCAGGACCCGGCCCTAGACAGTGAGTACGCGACCAAGTTGAAAATGAAGTGTCTAAACACGACCGACAACGTGACCATTGTG
GAGATGGACCCGGGGAGTTTCCGGACGTTCGACCTAAGCTACTTCCAGCTGGTCCAAAAGAGGAGAGGGTTGTTCCAATCCGACGCCGCATTGAGCACGAGTAGTACCACGATGTCGCTC
ATCAACCAGTTCGGTTCGGGTACCGTTCAGAACTTCTTCACCGAGTTTGCTCTGTCTATGGAGAAGATGGGCCGGATCAATGTGAAGACCGGGTCGGCTGGTGAGATCCGGAGGAATTGT
GCCGTGGTTAATTAA

Retrieve as FASTA