Entry information : AtPrx28 (At3g03670 / PER28 / AtperoxP28 / ATP39)
Entry ID 121
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx28 (At3g03670 / PER28 / AtperoxP28 / ATP39)
Name (synonym) AtPrx28 (At3g03670 / PER28 / AtperoxP28 / ATP39)
Class Class III peroxidase    [Orthogroup: Prx130]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flowers
Roots
Siliques
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx28
start..stop
S start..stop
AlyPrx28 599 0 1..321 1..321
BrPrx28-1Aa_other 528 0 1..321 1..323
CrubPrx37 521 0 1..321 1..322
BstrPrx48 518 0 1..321 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 903146..903349 204 N° 2 902380..902843 464 N° 3 901985..902282 298  
complement(join(901985..902282,902380..902843,903146..903349))


exon

Literature and cross-references AtPrx28 (At3g03670 / PER28 / AtperoxP28 / ATP39)
Protein ref. UniProtKB:   Q9SS67
DNA ref. Phytozome 12:   Chr3 (903349..901985)
mRNA ref. GenBank:   NM_111238.2
Cluster/Prediction ref. Phytozome Gene 12:   19660528 UniGene:   At.40941
Omic ref. AtProteome:   At3g03670 ATTED-II:   At3g03670 e-FP Browser:   At3g03670 ePlant:   At3g03670 Genevestigator:   At3g03670 RnR:   At3g03670 TAIR:   At3g03670
Protein sequence: AtPrx28 (At3g03670 / PER28 / AtperoxP28 / ATP39)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (300)
PWM (Da):   %s   34400.4 (32099.0) Transmb domain:   %s   i5-23o
PI (pH):   %s   4.82 (4.71) Peptide Signal:   %s   cut: 22 range:22-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKIATFSVLLLLLFIFPVALAQLKFKFYSESCPNAETIVENLVRQQFARDPSITAALTRMHFHDCFVQGCDASLLIDPTTSQLSEKNAGPNFSVRGFELIDEIKTALEAQCPSTVSCSDIVTLATRDAVFLGGGPSYVVPTGRRDGFVSNPEDANEILPPPFISVEGMLSFFGNKGMNVFDSVALLGAHTVGIASCGNFVDRVTNFQGTGLPDPSMDPTLAGRLRNTCAVPGGFAALDQSMPVTPVSFDNLFFGQIRERKGILLIDQLIASDPATSGVVLQYASNNELFKRQFAIAMVKMGAVDVLTGSAGEIRTNCRAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns 1 and 3'), 3 cDNA and 5 ESTs. Containing IntR (3').
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTGGGTCGG GTCGGTAGGA TAAATTCAAA CTTGGCCCAG CCCAATGCAC TTAAAGAGCG GGCTTCACCT CAGCATGTTA ATTAATTTTA ACCACAATCC TTTTCTTTTT TTTTTGAGCA  ACAACTTTTA ACCACAATCC TAAAATGTCA ATTTAAACCA AATTCATTAG TGATTCTTGG TCCACCAGCA AATTTCCAAA ATAAATTATT TTTCTTATCA TTTAAGAAAA TAACAAACAT  ATAATATTGT TTACTATACT AATTATTACA TTAATGTTGT ACAAAGTTTA CCTTGTAAGA AAACCGATAT TTTAATTTAT TTTAAACAAA AATATAAAAC GTTTCATTTA TGGATAAGTG  AGGATGGGAA CCATATGAGA CTCATAATCG CCGTCTGCAA CTATTATAAT CAGCATTCAG CAAAATCCAT TATTTTAAAG ATTATTGATG AGAAGATGAC CCTAATTAAA CCGCCAGAGT  AGTACTAGCT AATACGGTAT AATTATAAAC ACATCCAACC AGGCCAATCA AACTATATAT AAAATCATGT CGGGAATTAC GTAAGGTATG CTAATATAAC GTACATCACA ATCCTCGCCA  TACATGTACA TCACAATCCG AGTCTTTCAT CAACTTGAGC AATATATAAC TACTAATGAA ACATTAGGTC CATCTTCCAT ATACACATAC CCAGAATCAA TTACTTTCTA GAAAATATAA  AGAAAGAAAT TTCCATCAAG TCAAAGGTAA GGCTTTTTAA ACCCTACATA CTTTAAATAT AATTAATGGG ATCCTAATTT GTTTTTAGGC AACGACAATT TCTTTACACA ATTCTCTACG  AAATATGCTT TGGTCTTATA TTTCCAATCA TGAAAGTAAC CAATAACAGT ATTATTATTT TGTTTGAAAA TGTCATAATC GTATGATGGC TCGTTATCTC CATGTTGATT AAGAGTGTTT  TTTATCTCAA GAAAATGTCA TGTTGAGAAA ATGTCATAAC AAACAAAAAG TAAGAGTTTT TTTTTTTTTT TTTTTGTATA GAGGAAATTA AGAACGAGTC TTTGCATTTT CATTAATTTA  ACTCCATGTT GATTTACATT TAATCGTATG ATGGCTCGTT TATCTTCTTC TTAGTACACT TGTTATTTAT TATGTAGATA AAATTGATTG TTTTGTGTCA TGGACTTTAA ATACATATAT  TAGTAACAAG ATTGTCTAAA ACTATAGTCT GACTCGTTAT CTCAAGAAAA AGTCAAAGGA TCTAATTTAC TACAAGAAAA TTGAGTTACC TTTCTGCCAT TTAATCAGTG TATATATCGG  ATTACAATCA AATTACTTCC AAACTTACAT TCACCTTATA CTAGTCAAGT AAATGCAACA TACATAGACG ATCGTAATAT TTCACTCAGT TAAAGATGTT TAAAAAACAC ACACATTATT  CACCCCATAA TATATATCCT AAACAACACG CCTCATGGAG ATAAGGAGAT TATGGCTCAT ACACGCCTCA TGTTCTGTTT CATAATTTCA ATCCATAACA AATTGGCATA CATAGATTAA  CTCTATAATA TCTCCTTTTT TTTTTTTTGG AAAAACTCAA TAGTATCTCT TTATAACTAT ATATATTGTC ATTTTATTTC CGATGTAGAA TTCTAATATC AGTCACTTTA TTAGCAACAT  TTATTTTCAT TTCCTAGCAG ACGTATCTCG TAAATAAAAT TTTCTTACAT ATACCAAAAG GCAGCGGAAT GTTTCAAAGT AGTCCGTACA TACGCCTTAT GGGTTTATAT ATAAATTTAC  CTCTCTTAAT TTATATGTAT TTGACTGACC TATTCGACAT ATACAAGATG TATTAAGTTC CTTTTAAAAT TAATTTTCTT TATAGACCGT CCATTTTGGC GTATATATAT ATAGTATTGG 
TTTATCTAAT TAAGAGGTAT CATAAACCTT TCTACAAGAA CATAGCACTA TTACATTGCA ACACTTTCTA CAAAAACAAG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGCTTTATAA CAAGTTTCTA TATCTGATTA TTGATTGTTT TTCCCTTAAT TTCCGCTTCT GATGATGAAT TGTGAATGGT GATTGTTTGC CTATATATGT ATGTACGTAT ATCTTTAAAA  TAAGGTTTGG TGAATCGATT TGGTAACAAC AATATGTTAT GTTGGTACGA GTTTTGAGTG AATTGTGATG TATTTTAGTT TTTTAGAGTC CAAAACTAAC TTCAGAGTTG CATATTTTTC  ATGCTCAAGA GCACTTGGAT ACGTAATTTA TTTTCTGGCT CTATCCAATT AATTTGAATT ATAGAAAGTT CCATTCTCTC AAGATTTTGT AAAGATTATA AAGATTTTTT ATAAGATCTT  AAGAGTTAAA ACTGTCCAAT AATTGAATTC ATCTCTTTCG GAACCATGCG GAAGTCTTAC CACTGTTGAA GAATCCAATA GAACAATTCA AAGTTATAGA ATTAGTTGTA GAGTCTAACT  TAGCTTTACT AATATATAAT ACATATTTTA TTTCTTGATT TTTGTTTTCT TCAATATCGA AACGACGAAA CCAACTAAAA CGCACTATGG ATACTTTCAA TATTTAGCAG CAAGCAGCTG  ACATTTTCCG ACATTTATAG TTTACCACAT AAATTTTACG ATAAAATAAA TTATTTTTAC AAAGAAAATA GGAAAATCTA AACTAGTTGA AACATACATC TTACCGACAA TAAAAGATTA  AAGATTCTGT CGATATCTAC TTTTGCTTAT AAGTATTATT ATCTCTTTAA GTACATCATC AATACACATC ATATATATAC TGTTTATCCA AAGGCACCGG AATGTTTCCC TTTACGTTTA  TAGTTTCACC TCTCTAATTT AAATAAGTTT GACTTACACG TATGTATAGT TATCTGTAGT GGATCTCATT ATGAGATTCT CATAGTTCTC ATAACTCATA GTCCAATCTT TGCTAATTAA 
TTATCCTATC AACCAGAGTA TATAAGCAAT GGATGAAATA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATTGCAACGTTTTCTGTTCTACTCTTGCTTTTATTTATTTTCCCCGTGGCATTAGCGCAGCTGAAATTTAAGTTTTACAGTGAATCGTGCCCTAATGCAGAGACTATCGTAGAA
AACCTGGTTCGCCAGCAGTTTGCTCGTGACCCTTCAATCACGGCCGCCTTGACTCGTATGCATTTTCACGACTGTTTTGTCCAG
GTATGAATCTCATCAAACATCCTCTTCAGGTTTAGT
ATCGTTAATTAGTTTTTTTTTTTGGTTAAGGGGGCCTTAAGAATATATCGTTACGTTTATTAGAAAAGAGATGCAATCAAAGAGAATTATGTAAGAAATTATTCAATCGAGTTAAAAACA
TAATAAATACGAGCAAAAAAATAAATAATTTCTGAAAATTGAATATTGTCTTCTTTGATTTTTCTCGTCTTAACTTGAATATTATTCATTTGATATATGTATGTGTAATTTTTCTGAAAA
CAACAAGTCGTTGACATTTCGTATAGGGCTGCGACGCTTCTCTCCTCATAGACCCAACGACGTCTCAACTATCGGAAAAAAACGCCGGCCCAAACTTTAGCGTGAGAGGGTTCGAGCTGA
TCGACGAGATCAAGACGGCACTCGAAGCTCAATGTCCCTCTACGGTCTCGTGCTCCGATATAGTCACGCTCGCCACACGTGACGCCGTGTTCTTAGGTGGAGGACCAAGCTACGTGGTCC
CCACCGGACGTCGCGATGGCTTTGTGTCGAATCCTGAAGACGCCAATGAGATCCTCCCTCCACCATTCATATCCGTCGAAGGCATGTTAAGTTTTTTCGGCAACAAAGGAATGAATGTTT
TTGATTCCGTAGCTCTTTTGGGGGCGCACACGGTTGGGATCGCGTCTTGTGGTAATTTTGTGGACCGGGTCACGAACTTTCAAGGAACCGGACTGCCCGACCCATCCATGGACCCCACTT
TGGCTGGCAG
GTAATTGAAATCTGGTTAAGCCGTGTTTACGTACGTGATTAACTATAGATGGGTTACGTACTTTACGTTATAAATTTAATATTTCTCATATATATAGGCTAAGGAACACA
TGTGCGGTTCCAGGCGGCTTCGCGGCACTGGACCAGTCGATGCCAGTAACGCCGGTCTCATTCGACAACTTGTTCTTTGGTCAGATCAGAGAGAGGAAAGGAATTTTGCTTATTGACCAA
CTGATCGCAAGCGACCCGGCCACTTCTGGTGTTGTACTTCAGTACGCGTCCAACAACGAACTATTCAAACGTCAGTTCGCAATCGCAATGGTGAAGATGGGAGCCGTTGACGTGCTTACC
GGTTCAGCTGGTGAGATCAGGACGAATTGTAGAGCATTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATTGCAACGTTTTCTGTTCTACTCTTGCTTTTATTTATTTTCCCCGTGGCATTAGCGCAGCTGAAATTTAAGTTTTACAGTGAATCGTGCCCTAATGCAGAGACTATCGTAGAA
AACCTGGTTCGCCAGCAGTTTGCTCGTGACCCTTCAATCACGGCCGCCTTGACTCGTATGCATTTTCACGACTGTTTTGTCCAG
GGCTGCGACGCTTCTCTCCTCATAGACCCAACGACG
TCTCAACTATCGGAAAAAAACGCCGGCCCAAACTTTAGCGTGAGAGGGTTCGAGCTGATCGACGAGATCAAGACGGCACTCGAAGCTCAATGTCCCTCTACGGTCTCGTGCTCCGATATA
GTCACGCTCGCCACACGTGACGCCGTGTTCTTAGGTGGAGGACCAAGCTACGTGGTCCCCACCGGACGTCGCGATGGCTTTGTGTCGAATCCTGAAGACGCCAATGAGATCCTCCCTCCA
CCATTCATATCCGTCGAAGGCATGTTAAGTTTTTTCGGCAACAAAGGAATGAATGTTTTTGATTCCGTAGCTCTTTTGGGGGCGCACACGGTTGGGATCGCGTCTTGTGGTAATTTTGTG
GACCGGGTCACGAACTTTCAAGGAACCGGACTGCCCGACCCATCCATGGACCCCACTTTGGCTGGCAG
GCTAAGGAACACATGTGCGGTTCCAGGCGGCTTCGCGGCACTGGACCAGTCG
ATGCCAGTAACGCCGGTCTCATTCGACAACTTGTTCTTTGGTCAGATCAGAGAGAGGAAAGGAATTTTGCTTATTGACCAACTGATCGCAAGCGACCCGGCCACTTCTGGTGTTGTACTT
CAGTACGCGTCCAACAACGAACTATTCAAACGTCAGTTCGCAATCGCAATGGTGAAGATGGGAGCCGTTGACGTGCTTACCGGTTCAGCTGGTGAGATCAGGACGAATTGTAGAGCATTC
AACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCATAAACC TTTCTACAAG AACATAGCAC TATTACATTG CAACACTTTC TACAAAAACA AGATGAAGAT TGCAACGTTT TCTGTTCTAC TCTTGCTTTT ATTTATTTTC CCCGTGGCAT  TAGCGCAGCT GAAATTTAAG TTTTACAGTG AATCGTGCCC TAATGCAGAG ACTATCGTAG AAAACCTGGT TCGCCAGCAG TTTGCTCGTG ACCCTTCAAT CACGGCCGCC TTGACTCGTA  TGCATTTTCA CGACTGTTTT GTCCAGGGCT GCGACGCTTC TCTCCTCATA GACCCAACGA CGTCTCAACT ATCGGAAAAA AACGCCGGCC CAAACTTTAG CGTGAGAGGG TTCGAGCTGA  TCGACGAGAT CAAGACGGCA CTCGAAGCTC AATGTCCCTC TACGGTCTCG TGCTCCGATA TAGTCACGCT CGCCACACGT GACGCCGTGT TCTTAGGTGG AGGACCAAGC TACGTGGTCC  CCACCGGACG TCGCGATGGC TTTGTGTCGA ATCCTGAAGA CGCCAATGAG ATCCTCCCTC CACCATTCAT ATCCGTCGAA GGCATGTTAA GTTTTTTCGG CAACAAAGGA ATGAATGTTT  TTGATTCCGT AGCTCTTTTG GGGGCGCACA CGGTTGGGAT CGCGTCTTGT GGTAATTTTG TGGACCGGGT CACGAACTTT CAAGGAACCG GACTGCCCGA CCCATCCATG GACCCCACTT  TGGCTGGCAG GCTAAGGAAC ACATGTGCGG TTCCAGGCGG CTTCGCGGCA CTGGACCAGT CGATGCCAGT AACGCCGGTC TCATTCGACA ACTTGTTCTT TGGTCAGATC AGAGAGAGGA  AAGGAATTTT GCTTATTGAC CAACTGATCG CAAGCGACCC GGCCACTTCT GGTGTTGTAC TTCAGTACGC GTCCAACAAC GAACTATTCA AACGTCAGTT CGCAATCGCA ATGGTGAAGA  TGGGAGCCGT TGACGTGCTT ACCGGTTCAG CTGGTGAGAT CAGGACGAAT TGTAGAGCAT TCAACTAAAG CTTTATAACA AGTTTCTATA TCTGATTATT GATTGTTTTT CCCTTAATTT 
CCGCTTCTGA TGATGAATTG TGAATGGTGA TTGTTTGCCT ATATATGTAT GTACGTATAT CTTTAAAATA AGGTTTGGTG AATCGATTTG GT 

Retrieve as FASTA