Entry information : LuPrx160(Lus10029062|PACid:23151807)
Entry ID 12105
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx160(Lus10029062|PACid:23151807)
Name LuPrx160(Lus10029062|PACid:23151807)
Class Class III peroxidase     [Orthogroup: Prx008]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx160
start..stop
S start..stop
LuPrx187 424 7e-151 1..293 1..322
GmPrx158 329 1e-113 9..293 8..320
MePrx27 328 4e-113 8..293 10..326
PatrPrx68 326 3e-112 5..293 7..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 331810..332025 216 N° 2 331439..331642 204 N° 3 331225..331331 107 N° 4 330797..331151 355
complement(join(330797..331151,331225..331331,331439..331642,331810..332025))


exon

Literature and cross-references LuPrx160(Lus10029062|PACid:23151807)
DNA ref. Phytozome 12:   scaffold376 (332025..330797)
Protein sequence: LuPrx160(Lus10029062|PACid:23151807)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   293 (268)
PWM (Da):   %s   31411.62 (28831.4)  
PI (pH):   %s   10.14 (10.29) Peptide Signal:   %s   cut: 26 range:26-293
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTSSVVMSLAMAMLLLVVGSSEAQLSTNFYSKSCPKLHEAILPVVQAAVRKEARMGASLLRLFFHDCFVNGCDGSILLDDTSSFTGEKNANPNRNSARAPPQTATPLEALTSSTTSRPPSRRLAPASYHAPTSSPSPPLGGPTWNVKLGRRDARTNPAADVQAKPSHQPVQRAGPRIYNENNIDGSLARTRRSNCPSRNGTGDNNLAPLDFQTPTSFDNRYFGNLVSQRGLLHSDQQLFSGAGSTDSIVRSYSTNEGAFKSDFASAMVKMGDISPLTGSSGEIRRNCRRPN*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. 5' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTACTTCTAGTGTTGTCATGAGCTTGGCTATGGCGATGCTGCTCCTAGTTGTTGGGAGCAGTGAAGCTCAGCTCTCCACGAACTTCTACTCGAAATCCTGCCCTAAGCTTCAC
GAAGCTATCCTCCCTGTCGTTCAGGCTGCTGTTAGGAAAGAAGCTCGCATGGGCGCTTCTCTTCTTCGCCTCTTCTTCCATGACTGCTTTGTCAAT
GTAAGACTTCTGTTTTTTATTATA
ATGAATGTCATATTTGTTATGTTCCAATCCATTAGTTGTTGTAAAGCCTGGTGGGCTTGGGCTGAAAAGGCTGTAGTTGGGTTTTCAGTTTGAAAAAGCCCATTAAAACTTTGCATTACT
AAATATTGGTCTGCTGTGGTCAGGGATGCGACGGCTCCATTCTGCTGGACGACACCTCCTCCTTCACCGGAGAGAAGAACGCCAACCCGAACCGCAACTCCGCCAGGGCACCACCCCAAA
CCGCAACTCCGCTAGAGGCTTTGACGTCATCGACAACATCAAGGCCGCCGTCGAGAAGGCTTGCCCCGGCGTCGTATCATGCGCCGACGTCCTCGCCATCTCCGCCC
GTGACTCCACCGT
CCTCGTAAGCTTCTTCTATTCGAATATTCAACGATCTAACAATTTAAAAATTGACATTTTTAATAACTAAATTACTATTAATTTTCCACGTCAGCTGGGGGGTCCCACCTGGAACGTGAA
ACTCGGGAGGCGAGACGCAAGGACAAATCCCGCCGCCGACGTCCAAGCAAAACCGTCTCACCAGCCGGTTCAACGCGCTGG
GTCTCTCAACCCGGGACCTGGTGGCTCTCTCCGGATCCC
ACACGATCGGCCAAGCGAGATGCACTTCGTTCAGGCCGAGAATCTACAACGAGAACAACATCGACGGGTCGTTAGCCCGGACCCGGAGATCCAATTGCCCGAGCCGGAACGGAACCGGAG
ACAACAACCTGGCGCCGCTCGATTTCCAGACCCCGACCTCGTTCGACAACCGCTACTTTGGAAACCTCGTCAGCCAGCGCGGGCTGCTACACTCCGACCAGCAGCTGTTCTCCGGCGCCG
GGTCTACCGACTCGATCGTTCGTAGCTACAGCACTAATGAGGGGGCGTTCAAGTCTGATTTCGCGTCGGCGATGGTGAAGATGGGAGATATTAGCCCTTTGACTGGATCGAGCGGCGAGA
TCAGGAGGAACTGCAGGAGGCCGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTACTTCTAGTGTTGTCATGAGCTTGGCTATGGCGATGCTGCTCCTAGTTGTTGGGAGCAGTGAAGCTCAGCTCTCCACGAACTTCTACTCGAAATCCTGCCCTAAGCTTCAC
GAAGCTATCCTCCCTGTCGTTCAGGCTGCTGTTAGGAAAGAAGCTCGCATGGGCGCTTCTCTTCTTCGCCTCTTCTTCCATGACTGCTTTGTCAAT
GGATGCGACGGCTCCATTCTGCTG
GACGACACCTCCTCCTTCACCGGAGAGAAGAACGCCAACCCGAACCGCAACTCCGCCAGGGCACCACCCCAAACCGCAACTCCGCTAGAGGCTTTGACGTCATCGACAACATCAAGGCCG
CCGTCGAGAAGGCTTGCCCCGGCGTCGTATCATGCGCCGACGTCCTCGCCATCTCCGCCC
CTGGGGGGTCCCACCTGGAACGTGAAACTCGGGAGGCGAGACGCAAGGACAAATCCCGCC
GCCGACGTCCAAGCAAAACCGTCTCACCAGCCGGTTCAACGCGCTGG
GCCGAGAATCTACAACGAGAACAACATCGACGGGTCGTTAGCCCGGACCCGGAGATCCAATTGCCCGAGCCGG
AACGGAACCGGAGACAACAACCTGGCGCCGCTCGATTTCCAGACCCCGACCTCGTTCGACAACCGCTACTTTGGAAACCTCGTCAGCCAGCGCGGGCTGCTACACTCCGACCAGCAGCTG
TTCTCCGGCGCCGGGTCTACCGACTCGATCGTTCGTAGCTACAGCACTAATGAGGGGGCGTTCAAGTCTGATTTCGCGTCGGCGATGGTGAAGATGGGAGATATTAGCCCTTTGACTGGA
TCGAGCGGCGAGATCAGGAGGAACTGCAGGAGGCCGAATTAA

Retrieve as FASTA