Entry information : LuPrx174 (Lus10031548|PACid:23155873)
Entry ID 12115
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-19 (Christophe Dunand)
Peroxidase information: LuPrx174 (Lus10031548|PACid:23155873)
Name (synonym) LuPrx174 (Lus10031548|PACid:23155873)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx174
start..stop
S start..stop
LuPrx84 648 0 1..325 1..325
LuPrx145 553 0 1..325 1..324
LuPrx203 538 0 1..325 1..323
RcPrx71 481 5e-173 9..325 6..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 819875..820081 207 N° 2 819591..819785 195 N° 3 819337..819499 163 N° 4 818838..819250 413
complement(join(818838..819250,819337..819499,819591..819785,819875..820081))


exon

Literature and cross-references LuPrx174 (Lus10031548|PACid:23155873)
Literature Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
DNA ref. Phytozome 12:   scaffold863 (820081..818838)
Protein sequence: LuPrx174 (Lus10031548|PACid:23155873)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35438.09 (32998.9) Transmb domain:   %s   i5-24o
PI (pH):   %s   10.02 (10.12) Peptide Signal:   %s   cut: 23 range:23-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERSCFVVVTLLAIMAFGSAQAQLKMNFYSKSCPKAEQIVLGYVNKHIHSAPSLAAPLLRMHFHDCFVRGCDASVMLNVTSKNNATEKTAAPNLTLRGFGFLDAIKKLLEKECPGVVSCADILALSARDSVASTGGPTWRVPTGRRDGRISNASEALNAIPPPTSNFTTLQTLFGNVGLNLKDLTLLSAAHTIGISHCNSFSKRLYNFTGRGNGQDPSLDNNYATKLKQKCVNTSDNTTIVEMDPGSFRTFDRSYFKLLQKRRGLFQSDAALTTSRTTKAFIDQFASGSIQNFFKEFALSMEKLGRINVKTGSAGEIRKTCAFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Experimental evidency of cell wall localization.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAAGTTGCTTCGTAGTTGTAACCCTTTTGGCCATCATGGCCTTTGGATCAGCTCAAGCTCAGCTCAAGATGAACTTCTACTCCAAGAGCTGCCCTAAAGCCGAGCAGATCGTG
TTGGGTTACGTCAACAAGCACATCCACAGCGCTCCTTCCCTCGCCGCCCCTCTCCTCCGGATGCATTTCCACGACTGCTTCGTCAGG
GTACGTGTTTAACTGTGTGATCATCTCTCTAGG
GTCTTAATTGCCGTCTCGTCCAACGACGCTTTATAACGATTTTCTTTTTGCAATAGGGATGTGATGCTTCTGTGATGTTGAACGTGACGTCGAAAAACAATGCGACGGAGAAGACTGCAG
CTCCGAATTTGACACTTCGAGGGTTCGGCTTTCTTGACGCGATCAAGAAACTGCTCGAGAAAGAATGCCCCGGAGTTGTCTCTTGTGCCGATATCCTCGCCCTGTCTGCTAGAGACTCTG
TTGCCTCTACA
GTGAGTATATTGTATATATATATATAGTCGTTATATATGATGAACATTTTTATCGTGTGATATTAATTGTGTTGTTCCTTTCTGAAAACAGGGCGGTCCCACCTGGAGA
GTTCCGACAGGGAGGAGGGATGGAAGAATCTCGAACGCCAGTGAGGCGTTGAACGCAATCCCCCCTCCGACTAGCAACTTCACCACCCTCCAGACGTTGTTTGGGAATGTCGGTCTCAAC
TTGAAGGACCTCACCCTACTTTCAG
GTAATTTTTAGTTAAATTATTGTTGTAATGTAACGGTTTTTGAAAAAAAATATTGAATCCATCTTTTTATGTACTTTTTTCCACAGCGGCCCACA
CGATAGGGATATCTCACTGCAACTCGTTCTCCAAGCGGCTGTACAACTTCACGGGGCGTGGGAACGGACAGGACCCGAGTCTGGACAACAACTACGCGACGAAGCTGAAGCAGAAGTGTG
TGAACACGAGCGACAACACGACCATCGTCGAGATGGACCCGGGGAGCTTCAGGACGTTCGACCGCAGCTACTTCAAGCTACTCCAGAAGAGGAGGGGATTGTTCCAATCCGACGCGGCAC
TGACCACGAGCAGGACCACGAAGGCGTTCATTGACCAATTCGCGTCCGGTTCGATCCAAAACTTCTTCAAGGAGTTCGCATTGTCGATGGAGAAGTTGGGTCGGATCAACGTGAAAACCG
GGTCGGCCGGAGAGATCCGGAAAACATGTGCCTTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAAGTTGCTTCGTAGTTGTAACCCTTTTGGCCATCATGGCCTTTGGATCAGCTCAAGCTCAGCTCAAGATGAACTTCTACTCCAAGAGCTGCCCTAAAGCCGAGCAGATCGTG
TTGGGTTACGTCAACAAGCACATCCACAGCGCTCCTTCCCTCGCCGCCCCTCTCCTCCGGATGCATTTCCACGACTGCTTCGTCAGG
GGATGTGATGCTTCTGTGATGTTGAACGTGACG
TCGAAAAACAATGCGACGGAGAAGACTGCAGCTCCGAATTTGACACTTCGAGGGTTCGGCTTTCTTGACGCGATCAAGAAACTGCTCGAGAAAGAATGCCCCGGAGTTGTCTCTTGTGCC
GATATCCTCGCCCTGTCTGCTAGAGACTCTGTTGCCTCTACA
GGCGGTCCCACCTGGAGAGTTCCGACAGGGAGGAGGGATGGAAGAATCTCGAACGCCAGTGAGGCGTTGAACGCAATC
CCCCCTCCGACTAGCAACTTCACCACCCTCCAGACGTTGTTTGGGAATGTCGGTCTCAACTTGAAGGACCTCACCCTACTTTCAG
CGGCCCACACGATAGGGATATCTCACTGCAACTCG
TTCTCCAAGCGGCTGTACAACTTCACGGGGCGTGGGAACGGACAGGACCCGAGTCTGGACAACAACTACGCGACGAAGCTGAAGCAGAAGTGTGTGAACACGAGCGACAACACGACCATC
GTCGAGATGGACCCGGGGAGCTTCAGGACGTTCGACCGCAGCTACTTCAAGCTACTCCAGAAGAGGAGGGGATTGTTCCAATCCGACGCGGCACTGACCACGAGCAGGACCACGAAGGCG
TTCATTGACCAATTCGCGTCCGGTTCGATCCAAAACTTCTTCAAGGAGTTCGCATTGTCGATGGAGAAGTTGGGTCGGATCAACGTGAAAACCGGGTCGGCCGGAGAGATCCGGAAAACA
TGTGCCTTTGTGAATTGA

Retrieve as FASTA