Entry information : LuPrx187(Lus10034207|PACid:23175832)
Entry ID 12124
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx187(Lus10034207|PACid:23175832)
Name LuPrx187(Lus10034207|PACid:23175832)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx187
start..stop
S start..stop
MePrx27 516 0 8..322 10..326
GmPrx328 512 0 9..322 8..320
GmPrx158 509 0 9..322 8..320
PtPrx68 508 0 2..322 4..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 64013..64228 216 N° 2 64770..64961 192 N° 3 65052..65612 561  
join(64013..64228,64770..64961,65052..65612)


exon

Literature and cross-references LuPrx187(Lus10034207|PACid:23175832)
DNA ref. Phytozome 12:   scaffold310 (64013..65612)
Protein sequence: LuPrx187(Lus10034207|PACid:23175832)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   34387.21 (31811.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.62 (9.62) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTSSVVMSLALVMLLLVVGSSNAQLSTNFYSKSCPKLHEAIFPVVQAAVKKEARMGASLLRLFFHDCFVNGCDGSILLDDTSSFTGEKNANPNRNSARGFDVVDNIKAAVEKACPGVVSCADVLAISARDSTVLLGGPTWNVKLGRRDARTASQSAANNGIPPPTSNLNRLTSRFNALGLSARDLVALSGSHTIGQARCTSFRPRIYNENNIDGSLARTRRSNCPSRNGTGDNNLAPLDFQTPTSFDNRYFGNLVSQRGLLHSDQQLFSGAGSTDSIVRSYSTNEGAFKSDFASAMVKMGDISPLTGSSGEIRRNCRRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTACTTCTAGTGTTGTCATGAGCTTGGCTCTTGTGATGCTGCTCCTAGTTGTTGGGAGCAGTAACGCTCAGCTGTCGACAAACTTCTACTCGAAATCCTGCCCCAAGCTTCAT
GAAGCTATCTTCCCTGTCGTTCAGGCTGCCGTCAAGAAAGAAGCTCGCATGGGCGCTTCTCTCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAT
GTAAGACTTCCGTTTTTTCATAAG
GAATGTCAATTTAAACTCCAACTAGTCACCTTAAATTTATCCAATGGGTTCTGTGTGGGGTATGTACCCCATAATATAGGACGGACCCACAGACATATATTTCTTACTAAGTCGGTTCTG
TCTCCCCTATTTCGTCCCGTTTTATGCATGACTTTTTATAAGATACAATGAACTTTACCTTATTATTTGAATATTAACTAAATTAGTAACAACAGAATTTCTTGCTTAATTCTTCATACT
ATCATATTTTTATGAGTTTTTCATTCAAAATTAAGTTGGATGGTATACGATAAAATATTTTTATTTCAATTCATCATGTAACATGTATGAATATTGAGATATCCGCACCATTTTAGAACA
TTGCAATTTCTACACTTTGTAGTTATAAAGGCTGGGGGGAGGGGGGCTGAAAAGGCTGTGTTGGGTTTTCATTTTGAAAAGCCCATTAAAACATTTTCTTGTTGTAGAAAAGCCCATTAA
AACATAGCATTCTTAAATTTTGGTCTACTATGGTCAGGGATGCGATGGCTCCATTCTGCTGGACGACACCTCCTCCTTCACCGGAGAGAAGAACGCCAACCCGAACCGCAACTCCGCCAG
GGGGTTCGACGTCGTCGATAACATCAAAGCCGCCGTCGAAAAGGCCTGCCCCGGCGTGGTATCATGCGCCGACGTCCTCGCCATCTCCGCCCGTGACTCCACCGTCCTC
GTAAGCTTCTT
CTATTCACATATTCAACGATCTAACAATTTAAAAATTGACATTTTTAATAACTAAATTACTATTAATTTTCCACGTCAGCTGGGGGGTCCCACCTGGAACGTGAAGCTAGGCAGGCGAGA
CGCAAGGACGGCGAGCCAATCCGCCGCGAACAACGGAATCCCGCCGCCGACGTCCAACCTAAACCGTCTCACCAGCCGGTTCAACGCGCTGGGTCTCTCAGCCCGAGACCTAGTGGCTCT
ATCCGGATCCCACACGATCGGGCAAGCGAGATGCACTTCGTTCAGGCCGAGGATCTACAACGAGAACAACATCGACGGGTCGTTGGCCCGGACCCGGAGATCCAACTGCCCGAGCCGAAA
CGGAACCGGAGACAACAACCTGGCGCCGCTCGATTTCCAGACCCCGACCTCGTTTGATAACCGCTACTTCGGAAACCTCGTCAGCCAGCGCGGGCTGCTCCACTCCGACCAGCAGCTGTT
CTCCGGCGCCGGATCCACTGACTCGATTGTTCGTAGTTACAGCACTAATGAGGGGGCGTTCAAGTCGGATTTCGCGTCGGCGATGGTGAAGATGGGAGATATTAGCCCGTTGACTGGATC
GAGCGGCGAGATCAGGAGGAATTGCAGGAGGCCGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTACTTCTAGTGTTGTCATGAGCTTGGCTCTTGTGATGCTGCTCCTAGTTGTTGGGAGCAGTAACGCTCAGCTGTCGACAAACTTCTACTCGAAATCCTGCCCCAAGCTTCAT
GAAGCTATCTTCCCTGTCGTTCAGGCTGCCGTCAAGAAAGAAGCTCGCATGGGCGCTTCTCTCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAT
GGATGCGATGGCTCCATTCTGCTG
GACGACACCTCCTCCTTCACCGGAGAGAAGAACGCCAACCCGAACCGCAACTCCGCCAGGGGGTTCGACGTCGTCGATAACATCAAAGCCGCCGTCGAAAAGGCCTGCCCCGGCGTGGTA
TCATGCGCCGACGTCCTCGCCATCTCCGCCCGTGACTCCACCGTCCTC
CTGGGGGGTCCCACCTGGAACGTGAAGCTAGGCAGGCGAGACGCAAGGACGGCGAGCCAATCCGCCGCGAAC
AACGGAATCCCGCCGCCGACGTCCAACCTAAACCGTCTCACCAGCCGGTTCAACGCGCTGGGTCTCTCAGCCCGAGACCTAGTGGCTCTATCCGGATCCCACACGATCGGGCAAGCGAGA
TGCACTTCGTTCAGGCCGAGGATCTACAACGAGAACAACATCGACGGGTCGTTGGCCCGGACCCGGAGATCCAACTGCCCGAGCCGAAACGGAACCGGAGACAACAACCTGGCGCCGCTC
GATTTCCAGACCCCGACCTCGTTTGATAACCGCTACTTCGGAAACCTCGTCAGCCAGCGCGGGCTGCTCCACTCCGACCAGCAGCTGTTCTCCGGCGCCGGATCCACTGACTCGATTGTT
CGTAGTTACAGCACTAATGAGGGGGCGTTCAAGTCGGATTTCGCGTCGGCGATGGTGAAGATGGGAGATATTAGCCCGTTGACTGGATCGAGCGGCGAGATCAGGAGGAATTGCAGGAGG
CCGAATTAA

Retrieve as FASTA