Entry information : LuPrx203 (Lus10039680|PACid:23165139)
Entry ID 12135
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-19 (Christophe Dunand)
Peroxidase information: LuPrx203 (Lus10039680|PACid:23165139)
Name (synonym) LuPrx203 (Lus10039680|PACid:23165139)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx203
start..stop
S start..stop
LuPrx145 639 0 1..323 1..324
LuPrx84 541 0 6..323 7..325
LuPrx174 538 0 1..323 1..325
MePrx24 491 8e-177 10..323 10..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1155463..1155666 204 N° 2 1155752..1155943 192 N° 3 1156033..1156195 163 N° 4 1156355..1156767 413
join(1155463..1155666,1155752..1155943,1156033..1156195,1156355..1156767)


exon

Literature and cross-references LuPrx203 (Lus10039680|PACid:23165139)
Literature Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
DNA ref. Phytozome 12:   scaffold15 (1155463..1156767)
Protein sequence: LuPrx203 (Lus10039680|PACid:23165139)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (302)
PWM (Da):   %s   35197.56 (32806.3)  
PI (pH):   %s   7.75 (8.00) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEGSHLFFTLLLAIFVASTQAQLQMNFYSQSCHRAEQIVLDYVKEHISNAPTLASPILRMHFHDCFVRGCDASVMINSTSNNTAEKAAAPNLTLRGFNFLDGLKSLLEKECPGVVSCADILALTARDSVALIGGPTWNVPTGRRDGRISNSSEALNAIPPPTSNFTTLQRLFGNVGLDLKDLVLLSAAHTIGISHCNSFSARLYNFTGRGNGQDPALDSEYATKLKMKCMNTTDNVTIVEMDPGSFRSFDLSYFQLVQKRRGLFQSDAALSTSSTTMSLINQFGSGSVQNFFTEFALSMEKMGRINVKTGSAGEIRRNCAVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Experimental evidency of cell wall localization.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGGATCCCATCTCTTCTTTACTCTTCTTTTGGCAATCTTTGTTGCATCAACTCAAGCTCAGCTCCAGATGAACTTCTACTCCCAGAGCTGCCACAGAGCAGAGCAGATCGTCCTA
GATTATGTCAAGGAACACATCTCCAATGCTCCCACCCTCGCCTCTCCGATCCTCCGAATGCATTTCCACGACTGCTTCGTCAGG
GTATATAAAGATCGAAAATTCATCAACCACTACATC
ATCCTTACTTAATTGGTCGAGTTTGATGATGATTTGATTTTGGATGCAGGGGTGTGATGCTTCTGTGATGATCAACTCGACTTCTAACAACACGGCTGAGAAGGCTGCGGCTCCGAATTT
GACTCTAAGAGGGTTTAACTTCCTCGACGGTCTCAAGAGCTTGCTCGAGAAAGAGTGCCCTGGCGTTGTCTCTTGTGCTGATATCCTTGCTCTTACGGCTAGAGACTCGGTTGCTCTTAT
T
GTAAGTTTTTATTTTTTTTACAAGCCAGTTCATTTCAATAATTCGAATTTTTGTTAGGTGGTTGATGAAATTATTCTTCTTCTTTTTAGGGTGGACCGACGTGGAATGTTCCAACGGGG
AGAAGGGACGGGAGGATCTCAAACTCGTCAGAGGCGCTTAACGCCATCCCTCCTCCGACGAGCAACTTCACCACCCTCCAGAGGTTATTCGGGAACGTTGGTCTCGATTTGAAGGACTTG
GTCCTCCTCTCCG
GTAATTAAATGTTTATTTATTTTATGATAATTTTTACTAGATAATTATCAACTTGTTAGCCGAGTTATGACGTTAGATCATATCATATATGATTCATTTTGAACCCT
CGTGATGTTAATAATCAAGTGATTTTTATTTTATTTAAAAATTATTATATAGCGGCCCACACGATCGGGATATCTCACTGCAACTCGTTCTCGGCCCGGCTTTACAACTTCACGGGTCGG
GGCAACGGGCAGGACCCGGCCCTGGACAGCGAGTATGCGACGAAGTTGAAAATGAAGTGTATGAACACGACCGACAATGTGACCATTGTGGAGATGGACCCGGGGAGTTTCAGGTCATTC
GATCTAAGCTACTTCCAGCTGGTCCAAAAGAGGAGAGGGTTGTTCCAATCCGATGCCGCATTGAGCACGAGTAGCACCACGATGTCGCTCATAAACCAGTTCGGTTCGGGTTCCGTTCAG
AACTTCTTCACCGAGTTTGCTCTGTCCATGGAGAAGATGGGCCGGATCAATGTGAAGACCGGGTCGGCTGGTGAGATCCGGAGGAATTGTGCCGTGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGGATCCCATCTCTTCTTTACTCTTCTTTTGGCAATCTTTGTTGCATCAACTCAAGCTCAGCTCCAGATGAACTTCTACTCCCAGAGCTGCCACAGAGCAGAGCAGATCGTCCTA
GATTATGTCAAGGAACACATCTCCAATGCTCCCACCCTCGCCTCTCCGATCCTCCGAATGCATTTCCACGACTGCTTCGTCAGG
GGGTGTGATGCTTCTGTGATGATCAACTCGACTTCT
AACAACACGGCTGAGAAGGCTGCGGCTCCGAATTTGACTCTAAGAGGGTTTAACTTCCTCGACGGTCTCAAGAGCTTGCTCGAGAAAGAGTGCCCTGGCGTTGTCTCTTGTGCTGATATC
CTTGCTCTTACGGCTAGAGACTCGGTTGCTCTTATT
GGTGGACCGACGTGGAATGTTCCAACGGGGAGAAGGGACGGGAGGATCTCAAACTCGTCAGAGGCGCTTAACGCCATCCCTCCT
CCGACGAGCAACTTCACCACCCTCCAGAGGTTATTCGGGAACGTTGGTCTCGATTTGAAGGACTTGGTCCTCCTCTCCG
CGGCCCACACGATCGGGATATCTCACTGCAACTCGTTCTCG
GCCCGGCTTTACAACTTCACGGGTCGGGGCAACGGGCAGGACCCGGCCCTGGACAGCGAGTATGCGACGAAGTTGAAAATGAAGTGTATGAACACGACCGACAATGTGACCATTGTGGAG
ATGGACCCGGGGAGTTTCAGGTCATTCGATCTAAGCTACTTCCAGCTGGTCCAAAAGAGGAGAGGGTTGTTCCAATCCGATGCCGCATTGAGCACGAGTAGCACCACGATGTCGCTCATA
AACCAGTTCGGTTCGGGTTCCGTTCAGAACTTCTTCACCGAGTTTGCTCTGTCCATGGAGAAGATGGGCCGGATCAATGTGAAGACCGGGTCGGCTGGTGAGATCCGGAGGAATTGTGCC
GTGGTTAATTAA

Retrieve as FASTA