Entry information : LuPrx207(Lus10041249|PACid:23179960)
Entry ID 12138
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-30 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx207(Lus10041249|PACid:23179960)
Name LuPrx207(Lus10041249|PACid:23179960)
Class Class III peroxidase    [Orthogroup: Prx229]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx207
start..stop
S start..stop
LuPrx120 525 0 1..348 1..354
LuPrx208 393 3e-137 59..348 59..349
MePrx105 389 4e-136 25..348 36..344
RcPrx24 371 9e-129 24..348 23..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1610582..1610872 291 N° 2 1610306..1610497 192 N° 3 1610024..1610186 163 N° 4 1609531..1609931 401
complement(join(1609531..1609931,1610024..1610186,1610306..1610497,1610582..1610 872))


exon

Literature and cross-references LuPrx207(Lus10041249|PACid:23179960)
DNA ref. Phytozome 12:   scaffold280 (1610872..1609531)
Protein sequence: LuPrx207(Lus10041249|PACid:23179960)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (322)
PWM (Da):   %s   37367.15 (34540.5) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.58 (8.41) Peptide Signal:   %s   cut: 27 range:27-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSTKTPIVFLLVSLLIFVLPYASHGKGHNGPSRNDDHHKGKGNGRPDKNPAVQSPIRKGCPQFETIARDIVWSRVATDPTLAPKLLRLHFHDCFVRGCDASILLDSTATNSAEKDAIPNQSVRGYEVIDEIKARVESVCPATVSCADILTLAARDAVSFQFKRPLWPVFGGRKDGRVSLASEALNLPAPFENITTLLQEFQSKGLDLQDLVVLSGAHTIGVSRCGLISGRLFNFSGRGDTDPSIAPGFASTLKARCSSPNSAGVTLELDPGSSTSFDAHYYQAVVGNQGLLQSDAALMTDQRSALLSRALASNQQLFFTMFARSMVKMGAIVEGSGGEIRRNCRFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Extra 3'. Stop is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCCACCAAGACACCCATCGTCTTCTTGCTTGTTTCTCTCTTGATTTTCGTCCTACCTTATGCCTCTCACGGCAAAGGCCATAATGGTCCTTCCCGGAACGATGATCATCATAAA
GGTAAGGGAAATGGACGGCCGGATAAGAACCCCGCGGTGCAGTCTCCAATCCGAAAGGGCTGCCCACAATTCGAAACGATTGCTAGGGATATCGTTTGGAGTAGGGTAGCTACTGACCCT
ACCTTGGCTCCCAAGCTACTCAGGCTGCACTTCCATGACTGCTTTGTCAGG
GTTAGTCTCTTACTAATCTAGCTATTTGAATATATTTTTACTTAGTTTTGACAATGTTGGATGATGTTA
ATTATATTAATGTAGGGTTGTGATGCGTCCATATTGTTGGATTCGACGGCTACGAATTCAGCAGAGAAAGATGCGATTCCAAATCAGTCCGTAAGAGGGTACGAGGTTATCGACGAGATT
AAAGCTCGAGTAGAATCGGTTTGCCCTGCAACAGTCTCTTGTGCTGATATCCTTACCTTAGCGGCAAGAGATGCTGTTTCTTTTCAG
GTAACTAAACTTAAAATTATAGTACTGTATATT
ATAATTACGTACTATAGGGTAATTACAGATCGAGAATTGGAGTTTAATTACATGAATTAATCGTTCATATGCATGCATGCATGCAGTTCAAAAGGCCACTGTGGCCGGTTTTCGGAGGGA
GGAAAGACGGTCGGGTTTCCTTAGCATCCGAAGCACTAAACTTACCGGCTCCTTTTGAAAATATTACTACGCTCCTCCAAGAATTCCAAAGCAAAGGCCTGGATCTTCAAGATCTCGTCG
TATTGTCAG
GTAACTAGCATTAAACCCCAAACCTCTAACTTTACCTGTCCAATTTCCGGTCCGATTCTGAAAAACCTTGACTAACATATAGAAATGAACAGGGGCGCACACAATCGGGGT
GAGTCGGTGCGGGTTGATATCGGGGAGGCTGTTCAATTTCAGTGGACGAGGGGACACCGACCCATCGATTGCGCCCGGGTTCGCTAGTACCCTAAAAGCACGATGTTCCAGTCCCAACTC
AGCTGGAGTAACCTTAGAGCTGGATCCTGGAAGCTCAACTTCCTTCGACGCCCACTACTACCAAGCTGTGGTTGGGAACCAGGGACTCTTGCAATCCGACGCTGCGTTGATGACGGACCA
GCGGTCGGCTCTGCTCAGCCGCGCTTTGGCGAGTAATCAGCAGCTTTTCTTCACCATGTTCGCTCGGTCGATGGTGAAGATGGGCGCCATTGTCGAAGGGAGTGGAGGAGAGATTAGGAG
GAACTGCCGCTTTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCCACCAAGACACCCATCGTCTTCTTGCTTGTTTCTCTCTTGATTTTCGTCCTACCTTATGCCTCTCACGGCAAAGGCCATAATGGTCCTTCCCGGAACGATGATCATCATAAA
GGTAAGGGAAATGGACGGCCGGATAAGAACCCCGCGGTGCAGTCTCCAATCCGAAAGGGCTGCCCACAATTCGAAACGATTGCTAGGGATATCGTTTGGAGTAGGGTAGCTACTGACCCT
ACCTTGGCTCCCAAGCTACTCAGGCTGCACTTCCATGACTGCTTTGTCAGG
GGTTGTGATGCGTCCATATTGTTGGATTCGACGGCTACGAATTCAGCAGAGAAAGATGCGATTCCAAAT
CAGTCCGTAAGAGGGTACGAGGTTATCGACGAGATTAAAGCTCGAGTAGAATCGGTTTGCCCTGCAACAGTCTCTTGTGCTGATATCCTTACCTTAGCGGCAAGAGATGCTGTTTCTTTT
CAG
TTCAAAAGGCCACTGTGGCCGGTTTTCGGAGGGAGGAAAGACGGTCGGGTTTCCTTAGCATCCGAAGCACTAAACTTACCGGCTCCTTTTGAAAATATTACTACGCTCCTCCAAGAA
TTCCAAAGCAAAGGCCTGGATCTTCAAGATCTCGTCGTATTGTCAG
GGGCGCACACAATCGGGGTGAGTCGGTGCGGGTTGATATCGGGGAGGCTGTTCAATTTCAGTGGACGAGGGGAC
ACCGACCCATCGATTGCGCCCGGGTTCGCTAGTACCCTAAAAGCACGATGTTCCAGTCCCAACTCAGCTGGAGTAACCTTAGAGCTGGATCCTGGAAGCTCAACTTCCTTCGACGCCCAC
TACTACCAAGCTGTGGTTGGGAACCAGGGACTCTTGCAATCCGACGCTGCGTTGATGACGGACCAGCGGTCGGCTCTGCTCAGCCGCGCTTTGGCGAGTAATCAGCAGCTTTTCTTCACC
ATGTTCGCTCGGTCGATGGTGAAGATGGGCGCCATTGTCGAAGGGAGTGGAGGAGAGATTAGGAGGAACTGCCGCTTTGTTAATTAA

Retrieve as FASTA