Entry information : LuPrx34(Lus10006778|PACid:23163542)
Entry ID 12154
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx34(Lus10006778|PACid:23163542)
Name LuPrx34(Lus10006778|PACid:23163542)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx34
start..stop
S start..stop
LuPrx106 627 0 1..336 1..323
EguPrx75 599 0 5..333 4..331
EgrPrx75 598 0 5..333 4..331
EcamPrx75 595 0 5..333 2..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 252881..253123 243 N° 2 252608..252796 189 N° 3 252103..252268 166 N° 4 251600..252012 413
complement(join(251600..252012,252103..252268,252608..252796,252881..253123))


exon

Literature and cross-references LuPrx34(Lus10006778|PACid:23163542)
DNA ref. Phytozome 12:   scaffold204 (253123..251600)
Protein sequence: LuPrx34(Lus10006778|PACid:23163542)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (315)
PWM (Da):   %s   38039.44 (35573.2)  
PI (pH):   %s   8.16 (8.21) Peptide Signal:   %s   cut: 22 range:22-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHHKALFFLCLLSLAVSAFAQQESVSNEETKTTGLVMDFYKDSCPQAEDIIREQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRSLSEKETDRSFGLRNFRYLDTIKEAVERECPGVVSCADILVLSGRDGIVALGGPHIPLKTGRRDGRKSRAEILEEYLPDHNESMSVVLDRFAAMGIDTPGLVALLGSHSVGRTHCVKLVHRLYPDVDPALNPDHVDHMLKKCPDAIPDPKAVQYVRNDRGTPMILDNNYYRNILENKGLLIVDHQLATDNRTKPYVKKMAKSQDYFFKHFARAITKLSENNPLTGDKGEIRRQCSVVNKMIH*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCATCACAAAGCTCTCTTCTTCTTGTGCTTGTTATCCTTAGCAGTCTCAGCATTTGCTCAACAAGAGTCCGTCAGCAATGAAGAAACCAAAACAACAGGGCTAGTGATGGACTTC
TACAAGGACAGCTGCCCTCAAGCAGAGGACATAATCAGAGAGCAAGTCAAGCTTCTTTACAAGAGGCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGACTGCGCTGTT
CAG
GTAAATTAAACAGCAATTGAACTTCAGTTTCAGAATTCCAAAATGCTTTCTTGTCGGTTTTGCCTGATGATGCTGTTTTTTCAGTCGTGTGATGCATCCCTGCTGTTGGATTCAACG
AGGAGGTCTCTGTCTGAAAAGGAGACAGACAGGAGCTTTGGTCTGAGGAATTTCAGGTACCTTGACACCATCAAAGAAGCTGTGGAGAGGGAATGCCCTGGAGTTGTTTCTTGTGCCGAC
ATTCTTGTCCTCTCCGGTAGAGATGGCATCGTTGCG
GTTAGTAGTTGTTTCATCGATCATCTTCCAACTTGCTAAAAAACTTGCTAGAAAAATCTGAATCTTGCAAATGGAAATTCTCAA
ATTCTTAAGTGTGATAGACTTGAGTTACTAGCAGAAACAGGTTGGTCAGAGACCTGGAGCAAGATTTTAAATTTGAAATGAATCTGAAAGCACACTAGGCAAAATTCGGAAATACACTTG
TCAAAAACTTCAATTTTGAAAATTGTTACTTTGGAACCGACTGAATTGACTTTCAACGGTGGTCTAGGTTCGTCCACTCCTAATTCAGCCGGTAGTGAACTTATGTGTTGATTAAAGCAT
GGAACTTTGATGCAGTTGGGAGGACCACACATACCACTAAAAACAGGAAGAAGGGATGGAAGGAAGAGCAGAGCAGAAATCCTTGAGGAATACCTTCCAGATCATAATGAGAGCATGTCT
GTAGTCCTTGACAGGTTTGCCGCCATGGGGATCGATACTCCTGGACTCGTTGCTTTGTTAG
GTACAACCCGATAACTCGAATTGTTGAAACTCGAAAGAGAGCATTTAGATTGATTTTTA
TATGATTCACTAACACATACATATGATTTAGGGTCACACAGCGTGGGAAGAACCCACTGCGTGAAGCTGGTTCATCGTCTGTACCCAGACGTCGACCCAGCTTTGAACCCTGACCATGTC
GACCACATGCTCAAGAAGTGCCCCGACGCGATCCCAGACCCGAAGGCAGTGCAGTACGTGCGAAATGACCGTGGCACCCCTATGATTCTGGACAACAACTACTACAGGAACATACTTGAG
AACAAAGGGCTGTTGATCGTAGATCACCAGCTTGCTACCGACAATAGGACTAAGCCTTACGTGAAGAAGATGGCTAAGAGCCAGGACTACTTCTTCAAGCACTTCGCCAGGGCAATCACC
AAGCTTTCAGAGAACAACCCCCTCACTGGAGATAAGGGTGAGATTAGGAGGCAGTGCAGCGTTGTCAACAAGATGATCCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCATCACAAAGCTCTCTTCTTCTTGTGCTTGTTATCCTTAGCAGTCTCAGCATTTGCTCAACAAGAGTCCGTCAGCAATGAAGAAACCAAAACAACAGGGCTAGTGATGGACTTC
TACAAGGACAGCTGCCCTCAAGCAGAGGACATAATCAGAGAGCAAGTCAAGCTTCTTTACAAGAGGCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGACTGCGCTGTT
CAG
TCGTGTGATGCATCCCTGCTGTTGGATTCAACGAGGAGGTCTCTGTCTGAAAAGGAGACAGACAGGAGCTTTGGTCTGAGGAATTTCAGGTACCTTGACACCATCAAAGAAGCTGTG
GAGAGGGAATGCCCTGGAGTTGTTTCTTGTGCCGACATTCTTGTCCTCTCCGGTAGAGATGGCATCGTTGCG
TTGGGAGGACCACACATACCACTAAAAACAGGAAGAAGGGATGGAAGG
AAGAGCAGAGCAGAAATCCTTGAGGAATACCTTCCAGATCATAATGAGAGCATGTCTGTAGTCCTTGACAGGTTTGCCGCCATGGGGATCGATACTCCTGGACTCGTTGCTTTGTTAG
GG
TCACACAGCGTGGGAAGAACCCACTGCGTGAAGCTGGTTCATCGTCTGTACCCAGACGTCGACCCAGCTTTGAACCCTGACCATGTCGACCACATGCTCAAGAAGTGCCCCGACGCGATC
CCAGACCCGAAGGCAGTGCAGTACGTGCGAAATGACCGTGGCACCCCTATGATTCTGGACAACAACTACTACAGGAACATACTTGAGAACAAAGGGCTGTTGATCGTAGATCACCAGCTT
GCTACCGACAATAGGACTAAGCCTTACGTGAAGAAGATGGCTAAGAGCCAGGACTACTTCTTCAAGCACTTCGCCAGGGCAATCACCAAGCTTTCAGAGAACAACCCCCTCACTGGAGAT
AAGGGTGAGATTAGGAGGCAGTGCAGCGTTGTCAACAAGATGATCCATTGA

Retrieve as FASTA