Entry information : LuPrx77(Lus10013631|PACid:23171567)
Entry ID 12182
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx77(Lus10013631|PACid:23171567)
Name LuPrx77(Lus10013631|PACid:23171567)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx77
start..stop
S start..stop
LuPrx13 649 0 1..331 1..330
LuPrx29 454 5e-162 5..331 4..319
LuPrx110 439 7e-156 5..331 4..325
EcamPrx48 393 3e-138 31..331 23..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 163851..164078 228 N° 2 162466..163233 768  
complement(join(162466..163233,163851..164078))


exon

Literature and cross-references LuPrx77(Lus10013631|PACid:23171567)
DNA ref. Phytozome 12:   scaffold317 (164078..162466)
Protein sequence: LuPrx77(Lus10013631|PACid:23171567)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (311)
PWM (Da):   %s   35485.91 (33171.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.94 (7.72) Peptide Signal:   %s   cut: 21 range:21-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVANKMSVLIVGYVFFLCNAVVVSSAGADGLKVGFYRSTCPEAETIVRRVVHKWFNNDRSIPAALLHLQFHDCFVNGCDASILIDSTAQNPSEKAAGPSQTVRGYDLLDAVKAELEAACPSRVSCADIVALATRDALVLAGGPTYALPTGRLDGVVSKPSDVKLPGPTLNISEAFTQFFQPLGFTLAEMVTLLGAHTVGVAHCSLFRDRISDFKGTGRPDPSMDPNLVVSLRKTCSTTGSNKNNSTNPTAFLDQNTSFAVDNSYYRELRSKKGVLSFDQALETDGSTTGIVSRFARSEVEFRKSFAAAMVKMGNIVGGGDGEIRKNCRVFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGCTAATAAGATGTCTGTGCTTATTGTGGGTTATGTCTTCTTTCTCTGCAACGCTGTTGTGGTATCATCTGCAGGCGCAGACGGTTTAAAAGTGGGGTTTTACAGATCGACCTGC
CCAGAAGCTGAAACCATTGTACGGAGGGTTGTTCACAAGTGGTTCAACAATGATAGATCCATCCCAGCTGCTCTGCTTCACTTGCAATTTCATGACTGTTTCGTCAAC
GTATGTATATCA
TAAGCTTTTCCTCTGCCTTCCATTGTTTTACATACAGATACAGAGCCATCAATTTCTCACTAAAGATTTTCCATTCTTATATAAGATGCCCCCTGGCGTAGTTAACATTGCTTTTTCCGT
TCAAAATACTATATAGAAGCTTTTGTATTATATATCAAATGAGTTCCGGTCATACAACTTTTGTACGGAGAGTTATACGGATCATACAAATGTGTATAAATTTGTATAAATTTTGTGACT
GTATTTCCAGTTGTTAGAATTAGAGTATGATTTTTAGATGACTGAGATTTATTAGCTCTTCTCGAATCGAATTCAAAAATTGTTTCTCTAACTTCAAATTCGGACTCCATCATCTAGTTG
TTCAATTTACTGATAAATTAAATACTAGATGGCTATCTTTCGTTATCCTAAGATTCATCTAGAAACTTATCCCAGATTAAAAATCAACATCATGAACAATCATTAAAGTTAAATAATTCG
TTGTAATGTGACACTTTGCTACTTCTTCCACTTCCAATTTTGAATCGTGATTCATGCCTTTGAATTTTGAAACCTTTTTTTTACTAATGCATCTCTCCCGGCCCGGCCCGTTGTTGTAAA
TGCAGGGATGTGACGCGTCGATACTGATAGATTCAACGGCCCAAAATCCATCTGAAAAAGCCGCGGGGCCCAGCCAAACAGTCCGAGGCTACGACCTCCTCGACGCCGTCAAGGCTGAGC
TGGAAGCCGCATGTCCGTCACGAGTTTCCTGTGCCGACATCGTCGCACTCGCCACCAGAGACGCATTGGTCCTCGCCGGCGGGCCGACCTACGCCCTCCCGACAGGAAGGCTGGACGGCG
TCGTCTCCAAACCCAGTGACGTCAAACTCCCCGGCCCCACACTTAACATCTCCGAAGCCTTCACTCAGTTCTTCCAACCGCTCGGCTTCACCCTCGCGGAAATGGTCACCCTCCTCGGGG
CCCACACTGTAGGGGTGGCCCACTGCTCCTTGTTTCGCGATCGGATCTCCGATTTCAAAGGAACCGGGCGGCCTGACCCGTCCATGGACCCGAACTTGGTGGTCAGCCTACGCAAGACCT
GCTCCACTACTGGAAGTAATAAAAATAATAGCACTAATCCCACAGCGTTTTTGGATCAGAATACATCGTTTGCTGTCGATAATTCCTACTACAGGGAGTTGAGAAGCAAGAAGGGAGTGC
TGTCTTTTGATCAGGCGTTGGAAACCGATGGTTCGACGACCGGAATAGTGTCGAGGTTCGCGAGGAGCGAGGTGGAGTTCAGAAAGAGCTTTGCGGCGGCGATGGTGAAGATGGGGAACA
TTGTTGGTGGTGGCGACGGTGAGATCAGGAAGAATTGTAGAGTGTTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGCTAATAAGATGTCTGTGCTTATTGTGGGTTATGTCTTCTTTCTCTGCAACGCTGTTGTGGTATCATCTGCAGGCGCAGACGGTTTAAAAGTGGGGTTTTACAGATCGACCTGC
CCAGAAGCTGAAACCATTGTACGGAGGGTTGTTCACAAGTGGTTCAACAATGATAGATCCATCCCAGCTGCTCTGCTTCACTTGCAATTTCATGACTGTTTCGTCAAC
GGATGTGACGCG
TCGATACTGATAGATTCAACGGCCCAAAATCCATCTGAAAAAGCCGCGGGGCCCAGCCAAACAGTCCGAGGCTACGACCTCCTCGACGCCGTCAAGGCTGAGCTGGAAGCCGCATGTCCG
TCACGAGTTTCCTGTGCCGACATCGTCGCACTCGCCACCAGAGACGCATTGGTCCTCGCCGGCGGGCCGACCTACGCCCTCCCGACAGGAAGGCTGGACGGCGTCGTCTCCAAACCCAGT
GACGTCAAACTCCCCGGCCCCACACTTAACATCTCCGAAGCCTTCACTCAGTTCTTCCAACCGCTCGGCTTCACCCTCGCGGAAATGGTCACCCTCCTCGGGGCCCACACTGTAGGGGTG
GCCCACTGCTCCTTGTTTCGCGATCGGATCTCCGATTTCAAAGGAACCGGGCGGCCTGACCCGTCCATGGACCCGAACTTGGTGGTCAGCCTACGCAAGACCTGCTCCACTACTGGAAGT
AATAAAAATAATAGCACTAATCCCACAGCGTTTTTGGATCAGAATACATCGTTTGCTGTCGATAATTCCTACTACAGGGAGTTGAGAAGCAAGAAGGGAGTGCTGTCTTTTGATCAGGCG
TTGGAAACCGATGGTTCGACGACCGGAATAGTGTCGAGGTTCGCGAGGAGCGAGGTGGAGTTCAGAAAGAGCTTTGCGGCGGCGATGGTGAAGATGGGGAACATTGTTGGTGGTGGCGAC
GGTGAGATCAGGAAGAATTGTAGAGTGTTTAATTAA

Retrieve as FASTA