Entry information : LuPrx84 (Lus10015127|PACid:23149524)
Entry ID 12186
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-18 (Christophe Dunand)
Peroxidase information: LuPrx84 (Lus10015127|PACid:23149524)
Name (synonym) LuPrx84 (Lus10015127|PACid:23149524)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx84
start..stop
S start..stop
LuPrx174 648 0 1..325 1..325
LuPrx145 558 0 1..325 1..324
LuPrx203 541 0 7..325 6..323
RcPrx71 482 3e-173 11..325 8..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 149717..149923 207 N° 2 150011..150205 195 N° 3 150310..150472 163 N° 4 150566..150978 413
join(149717..149923,150011..150205,150310..150472,150566..150978)


exon

Literature and cross-references LuPrx84 (Lus10015127|PACid:23149524)
Literature Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
DNA ref. Phytozome 12:   scaffold866 (149717..150978)
Protein sequence: LuPrx84 (Lus10015127|PACid:23149524)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35611.04 (33085.8)  
PI (pH):   %s   9.65 (9.92) Peptide Signal:   %s   cut: 23 range:23-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERNCFIVLTLLAIMAFGSTEAQLKMNFYSKSCPKAEQIVSDYVNKHIHNAPSLAAPLLRMHFHDCFVRGCDASVMLNVTAKNNATEKTAAPNLTLRGFGFLDAIKKLLEKECPGVVSCADILALSARDSVASTGGPTWRVPTGRRDGRISNASEALNAIPPPTSNFTTLQRLFGNVGLNLKDLTLLSAAHTIGISHCNSFSERLYNFTGRGNGQDPRLDNNYATKLKQKCVNTSDNTTIVEMDPGSFRTFDRSYFKLLQKRRGLFQSDAALTTSGTTKAFIDQFASGSIQNFFKEFALSMEKMGRINVKTGSAGEIRKTCAFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Experimental evidency of cell wall localization
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAAATTGCTTCATAGTTCTAACCCTCTTGGCCATCATGGCCTTTGGATCAACTGAAGCTCAGCTTAAGATGAACTTCTACTCCAAGAGCTGCCCTAAAGCCGAGCAGATCGTG
TCGGATTACGTCAACAAGCACATCCACAATGCCCCTTCCCTCGCCGCCCCTCTTCTCCGGATGCATTTCCACGACTGCTTCGTCAGG
GTACGTTGTAACTGTTTGCTTAGTTCTCTCAAG
TCTTTAATTACCATCTCGGCCAACCCTTTATAATGATTTTTGGTTGTGTTATAGGGATGTGATGCTTCGGTGATGTTGAATGTGACGGCGAAAAACAATGCGACGGAGAAGACTGCAGCT
CCGAATTTGACCCTCAGAGGGTTCGGCTTTCTTGATGCTATCAAGAAACTGCTCGAGAAAGAATGCCCTGGAGTTGTCTCTTGTGCTGATATCCTTGCTCTGTCTGCTAGAGACTCTGTT
GCCTCTACC
GTGAGTATATTATATTATACATAGTCGTTATGATGAACATGATTATTGTGTGATATTTATTGTGCGCATGTCAATGATTCGAGTTGTTATTTTTTTGAAAACAGGGCGGTC
CTACCTGGAGAGTTCCGACAGGGAGGAGGGACGGGAGAATCTCGAACGCTAGTGAGGCGTTGAACGCAATCCCCCCTCCGACTAGCAACTTCACCACCCTCCAGAGGTTGTTTGGGAATG
TCGGTCTCAACTTGAAGGACCTTACCCTACTTTCAG
GTAATTTTTATTTTTTTAGCAAAATTATCATTACAATGTAACGGTTTTTGAAAAAAAATCTAATACGTCTTTTTACGCACTTTT
TTCCCACAGCGGCCCACACGATAGGGATATCTCACTGCAACTCGTTCTCCGAGCGGCTATACAACTTCACTGGGCGTGGGAACGGGCAGGACCCGAGACTGGACAACAACTACGCGACCA
AGCTGAAGCAAAAGTGCGTGAACACGAGCGACAACACGACCATCGTGGAGATGGACCCTGGTAGCTTCAGGACTTTCGACCGCAGCTACTTCAAACTGCTCCAAAAGAGGAGAGGGTTGT
TCCAATCCGACGCGGCCCTGACCACGAGCGGGACCACGAAGGCGTTCATCGACCAGTTCGCGTCCGGTTCGATCCAGAACTTCTTCAAGGAGTTCGCATTGTCGATGGAGAAGATGGGTC
GGATCAACGTGAAAACCGGGTCGGCCGGGGAGATCCGGAAGACATGTGCCTTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAAATTGCTTCATAGTTCTAACCCTCTTGGCCATCATGGCCTTTGGATCAACTGAAGCTCAGCTTAAGATGAACTTCTACTCCAAGAGCTGCCCTAAAGCCGAGCAGATCGTG
TCGGATTACGTCAACAAGCACATCCACAATGCCCCTTCCCTCGCCGCCCCTCTTCTCCGGATGCATTTCCACGACTGCTTCGTCAGG
GGATGTGATGCTTCGGTGATGTTGAATGTGACG
GCGAAAAACAATGCGACGGAGAAGACTGCAGCTCCGAATTTGACCCTCAGAGGGTTCGGCTTTCTTGATGCTATCAAGAAACTGCTCGAGAAAGAATGCCCTGGAGTTGTCTCTTGTGCT
GATATCCTTGCTCTGTCTGCTAGAGACTCTGTTGCCTCTACC
GGCGGTCCTACCTGGAGAGTTCCGACAGGGAGGAGGGACGGGAGAATCTCGAACGCTAGTGAGGCGTTGAACGCAATC
CCCCCTCCGACTAGCAACTTCACCACCCTCCAGAGGTTGTTTGGGAATGTCGGTCTCAACTTGAAGGACCTTACCCTACTTTCAG
CGGCCCACACGATAGGGATATCTCACTGCAACTCG
TTCTCCGAGCGGCTATACAACTTCACTGGGCGTGGGAACGGGCAGGACCCGAGACTGGACAACAACTACGCGACCAAGCTGAAGCAAAAGTGCGTGAACACGAGCGACAACACGACCATC
GTGGAGATGGACCCTGGTAGCTTCAGGACTTTCGACCGCAGCTACTTCAAACTGCTCCAAAAGAGGAGAGGGTTGTTCCAATCCGACGCGGCCCTGACCACGAGCGGGACCACGAAGGCG
TTCATCGACCAGTTCGCGTCCGGTTCGATCCAGAACTTCTTCAAGGAGTTCGCATTGTCGATGGAGAAGATGGGTCGGATCAACGTGAAAACCGGGTCGGCCGGGGAGATCCGGAAGACA
TGTGCCTTTGTGAATTGA

Retrieve as FASTA