Entry information : LuPrxII119(Lus10021932|PACid:23158023)
Entry ID 12190
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrxII119(Lus10021932|PACid:23158023)
Name LuPrxII119(Lus10021932|PACid:23158023)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII002]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrxII119
start..stop
S start..stop
CclPrxII05 338 5e-119 55..255 24..224
CsPrxII05 335 2e-118 55..255 3..203
ThasPrxII03 329 4e-116 55..255 1..201
PtPrxII06 327 5e-115 55..255 1..203
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 646807..647184 378 N° 2 646686..646715 30 N° 3 646314..646472 159 N° 4 646132..646226 95
N° 5 645936..646041 106  
complement(join(645936..646041,646132..646226,646314..646472,646686..646715,6468 07..647184))


exon

Literature and cross-references LuPrxII119(Lus10021932|PACid:23158023)
DNA ref. Phytozome 11:   scaffold164 (647184..645936)
Protein sequence: LuPrxII119(Lus10021932|PACid:23158023)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   256
PWM (Da):   %s   27760.58  
PI (pH):   %s   10.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGQAQLISINLVQPSLVSLPHHPPHSQHRRRLKKTSSIYTTTVHKYRNLNQATEMASAVVRRAKASAFKSVVGSLRVAGSSRSYAKVAVGADLVSAAPDVALQKARTWDEGVSSKFSTTPLKDIFKGKKVVIFGLPGAYTGVCSQQHVPSYKNNADKFKAKGIDSIICVSVNDPYVMNGWAEKLQAKDDLEFYGDFDGKFHKSLELTKDLSGALLGPRSERWSAYVDDGKVKVLNVEEVPSDFKVSGGEVILGLI

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Extra 5' end.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCCAGGCCCAATTAATCTCAATCAACCTAGTCCAGCCGTCTCTGGTCTCACTTCCTCATCATCCACCGCACTCTCAACATCGGCGAAGGCTGAAGAAAACTTCGAGCATCTACACA
ACCACAGTCCACAAGTATCGGAATCTTAATCAAGCAACAGAGATGGCATCTGCAGTAGTTAGAAGAGCCAAGGCGTCGGCATTCAAGTCGGTGGTCGGCAGTCTACGAGTGGCTGGATCG
TCGAGATCCTACGCCAAGGTTGCCGTTGGGGCTGATCTAGTATCGGCCGCCCCCGATGTCGCCCTCCAGAAAGCTCGCACCTGGGACGAAGGCGTCTCTTCCAAATTCTCCACTACCCCT
CTCAAAGACATTTTCAAG
GTCCAAATCCACTGCCCATTTTGTACTTAATTTTTTCTACATTCGACAACTTTTGTTTTTTCCACTGATTCTTGTATTTTTTCTGTGCCAGGGCAAGAAAGT
TGTCATCTTTGGTCTTCCA
GTAAGTCTCTCTACCTGTCAAATTGTTGCTTTGGCTGCTCTTTGCTGTGATTGATTTATCATATTTCTGTCCTGTACGGAAATTCGATGTGAATTTCATTT
CGAAATGTCTGGCAAGATTATTGATGTCAGAAACTCCTGAAACGAGCCAGCTCATTCAAAAGTTCCAATGGCTTTTGGTAATGTCTTGTTTGGCCTTTGCTTTTATCTCCAGGGTGCATA
CACAGGTGTTTGCTCGCAGCAGCATGTCCCTAGTTACAAGAACAACGCAGATAAGTTCAAGGCTAAAGGAATTGATTCGATCATTTGCGTGTCGGTTAACGACCCTTATGTGATGAATGG
TTGGGCAGAGAAACTTCAAGCTAAAGATGAT
GTAAGTTAGTTAACAAAAGGATGAGCCTTTTGCTTCTCTAGTAGATTATCTATGACTTTACACGTGCTCTTTCGCTCCCCGTCTCAGCT
CGAATTCTACGGAGACTTTGATGGGAAGTTCCACAAGAGCTTGGAGCTAACTAAGGATCTCTCTGGTGCTTTGCTTGGACCTCGCTCTGAAAG
GTATATATACTATTGCATCTGTAATAT
CCAAGACATGTCTTATACTCTATCCTTTTCTTACTGTGATCATTGTGGATTTTGCCTGTGTAGATGGTCTGCTTATGTTGATGATGGGAAAGTTAAGGTCCTTAATGTCGAGGAAGTCCC
GTCGGATTTCAAGGTTTCTGGCGGTGAGGTTATTTTGGGACTGATATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCCAGGCCCAATTAATCTCAATCAACCTAGTCCAGCCGTCTCTGGTCTCACTTCCTCATCATCCACCGCACTCTCAACATCGGCGAAGGCTGAAGAAAACTTCGAGCATCTACACA
ACCACAGTCCACAAGTATCGGAATCTTAATCAAGCAACAGAGATGGCATCTGCAGTAGTTAGAAGAGCCAAGGCGTCGGCATTCAAGTCGGTGGTCGGCAGTCTACGAGTGGCTGGATCG
TCGAGATCCTACGCCAAGGTTGCCGTTGGGGCTGATCTAGTATCGGCCGCCCCCGATGTCGCCCTCCAGAAAGCTCGCACCTGGGACGAAGGCGTCTCTTCCAAATTCTCCACTACCCCT
CTCAAAGACATTTTCAAG
GGCAAGAAAGTTGTCATCTTTGGTCTTCCAGGTGCATACACAGGTGTTTGCTCGCAGCAGCATGTCCCTAGTTACAAGAACAACGCAGATAAGTTCAAGGCT
AAAGGAATTGATTCGATCATTTGCGTGTCGGTTAACGACCCTTATGTGATGAATGGTTGGGCAGAGAAACTTCAAGCTAAAGATGAT
CTCGAATTCTACGGAGACTTTGATGGGAAGTTC
CACAAGAGCTTGGAGCTAACTAAGGATCTCTCTGGTGCTTTGCTTGGACCTCGCTCTGAAAG
ATGGTCTGCTTATGTTGATGATGGGAAAGTTAAGGTCCTTAATGTCGAGGAAGTCCCG
TCGGATTTCAAGGTTTCTGGCGGTGAGGTTATTTTGGGACTGATATGA

Retrieve as FASTA