Entry information : LuPrxII124(Lus10023180|PACid:23170446)
Entry ID 12191
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrxII124(Lus10023180|PACid:23170446)
Name LuPrxII124(Lus10023180|PACid:23170446)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrxII124
start..stop
S start..stop
LuPrxII83 328 9e-118 1..164 1..164
LuPrxII125 313 6e-112 1..164 1..164
CclPrxII02 285 1e-100 1..162 1..162
CsPrxII02 285 2e-100 1..162 1..162
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 826632..826786 155 N° 2 826463..826542 80 N° 3 825654..825913 260  
complement(join(825654..825913,826463..826542,826632..826786))


exon

Literature and cross-references LuPrxII124(Lus10023180|PACid:23170446)
DNA ref. Phytozome 11:   scaffold325 (826786..825654)
Protein sequence: LuPrxII124(Lus10023180|PACid:23170446)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   165
PWM (Da):   %s   17425.2  
PI (pH):   %s   6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPIAAGASLPDGTLAHFDENDQLQQVSIHSLAAGKKVVIVGVPGAFTPTCSLKHVPGFIERADDLKAKGVAEIITIVNDPFVMKAWAKTFPENKHVKFLADGSATYTHALGVELDLKEKGLGIRSRRFALLVDDLKVKAANIEEGGDFTVSSVDDIIKALDA

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCGATAGCTGCCGGTGCTTCCTTACCTGACGGAACTCTCGCTCACTTCGACGAGAACGATCAGCTCCAGCAGGTCTCCATCCACTCGCTCGCCGCCGGCAAGAAGGTCGTCATC
GTCGGTGTCCCCGGCGCCTTCACTCCAACTTGCAG
GTCATTCACAATCTTCTCTCTGATTCTTCCATTTCCCGCAATTGTGGAGGCATTAATCGCTTCAAGTATGGTTTTCTGTTTATAC
GCAGCTTGAAGCATGTACCTGGATTCATCGAAAGAGCGGATGACCTCAAAGCCAAAGGTGTTGCAGAGATAATCACTATTAGCGGTAGTTGCTCGATTCCCTCCCCCTCCCATTTGTTTG
ACAATAATGATCTAATTCCGCTCTTCGTTTTCTAGCTTACAAACTAGATTTCAATGTCCTGTTTGTTCAATTAGCAGAATTCATTTCTACCCACCTGCTGACTGGCCCCTTTGACGAATT
AGAATGAATTAGGTTCTGTAGCAATATTGTAAAATTGAATTCTCCACAGCTATAAACGAGTGAAGAGAACTCTAACCAAATGAATATATGACAGACTTACTTAAGATTTGGATTGAGATT
TAGTTCTTGGTCTTGAAAAGTGTATTTTTGGAAATGATGGTTATGAATGGTCCGTGCTTGAGTCATATATTGTGAAAATTCAGTATTATATTCTACTGAATTCTTGTCTTCCCTGCGGAT
GCCATGGCCTGGATTTTGGTAAACAAACATGATATTGAGTTTTGGGATTCGTGGAGAGAAGTTAAAAAGCAAAAGTTGCTCACCATTTTAATTGGGAGATATGGACATATCCTGACAATC
TGACATGGTTATTTGGATAAACTATATCTGCAGTGAATGATCCATTTGTGATGAAAGCTTGGGCAAAGACCTTCCCAGAGAACAAGCACGTGAAGTTCTTGGCAGATGGCTCTGCAACTT
ACACCCATGCTCTGGGTGTTGAGCTTGACCTAAAAGAGAAGGGACTAGGGATCAGGTCAAGGAGGTTTGCTCTACTGGTCGATGACCTCAAGGTGAAGGCTGCAAACATTGAAGAGGGTG
GAGACTTCACAGTTTCAAGTGTTGATGATATCATCAAGGCCCTTGATGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCGATAGCTGCCGGTGCTTCCTTACCTGACGGAACTCTCGCTCACTTCGACGAGAACGATCAGCTCCAGCAGGTCTCCATCCACTCGCTCGCCGCCGGCAAGAAGGTCGTCATC
GTCGGTGTCCCCGGCGCCTTCACTCCAACTTGCAG
CTTGAAGCATGTACCTGGATTCATCGAAAGAGCGGATGACCTCAAAGCCAAAGGTGTTGCAGAGATAATCACTATTAGCGTGAAT
GATCCATTTGTGATGAAAGCTTGGGCAAAGACCTTCCCAGAGAACAAGCACGTGAAGTTCTTGGCAGATGGCTCTGCAACTTACACCCATGCTCTGGGTGTTGAGCTTGACCTAAAAGAG
AAGGGACTAGGGATCAGGTCAAGGAGGTTTGCTCTACTGGTCGATGACCTCAAGGTGAAGGCTGCAAACATTGAAGAGGGTGGAGACTTCACAGTTTCAAGTGTTGATGATATCATCAAG
GCCCTTGATGCTTGA

Retrieve as FASTA