Entry information : LuPrxII125(Lus10023662|PACid:23148272)
Entry ID 12192
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrxII125(Lus10023662|PACid:23148272)
Name LuPrxII125(Lus10023662|PACid:23148272)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrxII125
start..stop
S start..stop
LuPrxII124 313 6e-112 1..164 1..164
LuPrxII83 312 2e-111 1..164 1..164
GhPrxII03 283 8e-100 1..162 1..162
GaPrxII03 283 8e-100 1..162 1..162
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 407661..407815 155 N° 2 407951..408030 80 N° 3 408176..408435 260  
join(407661..407815,407951..408030,408176..408435)


exon

Literature and cross-references LuPrxII125(Lus10023662|PACid:23148272)
DNA ref. Phytozome 11:   scaffold505 (407661..408435)
Protein sequence: LuPrxII125(Lus10023662|PACid:23148272)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   165
PWM (Da):   %s   17385.15  
PI (pH):   %s   4.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPIAAGATLPEGTLAFFDENDQLQQVSIHSLAAGKKVVIVGVPGAFTPTCSLKHVPGFIERAGDLKAKGVAEIITIVNDPFVMKAWSKTFPENKDVKFLADGSATYTHALGLELDLNEKGLGIRSRRFALLVDDLKVKAANVEEGGDFTVSSVDDIIKALDA

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCATCGCTGCCGGTGCTACCTTGCCTGAGGGAACCCTCGCTTTCTTCGATGAGAACGATCAGCTCCAGCAGGTCTCCATCCACTCACTCGCCGCCGGCAAGAAGGTTGTCATC
GTTGGCGTTCCCGGCGCATTTACTCCTACCTGCAG
GTCCTTTCAATCATCTCTCTCGTTTCTTTTGGCTCCATCTTTCTTTTAAGTTAATTGTTGTTTGCGATCTATTTTTTATGGCCAA
CATTGTGAATTTTGATTTTTGGAATTGGTGTTTGACTGATTTTTGAACAGCTTGAAGCATGTTCCTGGATTCATCGAGAGAGCTGGGGATCTCAAAGCTAAGGGCGTTGCTGAGATCATC
ACTATTAGCG
GTAATTGTTCTTAATATTAACTGTTGCATGCCTCAATTCGACTATATATAACGTGTTTGGAGTAGTGACTCGATCACTTCAGTTTCATCCTCTCATGAGAGGTGTGATTC
TAACTTGGTGCATTAATTGGATCCTGTAATTGCAGTGAATGATCCATTTGTGATGAAGGCTTGGTCCAAGACATTCCCAGAGAACAAAGACGTTAAGTTCTTGGCTGATGGATCTGCGAC
ATACACCCATGCTCTGGGTCTTGAGCTTGATTTGAACGAGAAGGGTCTAGGAATCAGGTCAAGGAGGTTTGCTCTGTTGGTCGATGACCTCAAAGTGAAGGCTGCAAACGTTGAAGAAGG
TGGTGACTTCACTGTTTCCAGCGTTGATGACATTATCAAGGCACTTGATGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCATCGCTGCCGGTGCTACCTTGCCTGAGGGAACCCTCGCTTTCTTCGATGAGAACGATCAGCTCCAGCAGGTCTCCATCCACTCACTCGCCGCCGGCAAGAAGGTTGTCATC
GTTGGCGTTCCCGGCGCATTTACTCCTACCTGCAG
CTTGAAGCATGTTCCTGGATTCATCGAGAGAGCTGGGGATCTCAAAGCTAAGGGCGTTGCTGAGATCATCACTATTAGCGTGAAT
GATCCATTTGTGATGAAGGCTTGGTCCAAGACATTCCCAGAGAACAAAGACGTTAAGTTCTTGGCTGATGGATCTGCGACATACACCCATGCTCTGGGTCTTGAGCTTGATTTGAACGAG
AAGGGTCTAGGAATCAGGTCAAGGAGGTTTGCTCTGTTGGTCGATGACCTCAAAGTGAAGGCTGCAAACGTTGAAGAAGGTGGTGACTTCACTGTTTCCAGCGTTGATGACATTATCAAG
GCACTTGATGCTTGA

Retrieve as FASTA