Entry information : AtPrx29 (At3g17070 / PER29 / AtperoxP29 / ATP40)
Entry ID 122
Creation 2006-02-06 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx29 (At3g17070 / PER29 / AtperoxP29 / ATP40)
Name (synonym) AtPrx29 (At3g17070 / PER29 / AtperoxP29 / ATP40)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type Vegetative tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx29
start..stop
S start..stop
AhalPrx23 674 0 1..339 1..339
AlyPrx29 663 0 1..339 1..339
BstrPrx17 652 0 1..339 1..339
CrubPrx64 626 0 1..339 1..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5821048..5821296 249 N° 2 5822319..5822679 361 N° 3 5822756..5823165 410  
join(5821048..5821296,5822319..5822679,5822756..5823165)


exon

Literature and cross-references AtPrx29 (At3g17070 / PER29 / AtperoxP29 / ATP40)
Protein ref. UniProtKB:   Q9LSP0
DNA ref. Phytozome 12:   Chr3 (5821048..5823165)
mRNA ref. GenBank:   NM_112583
Cluster/Prediction ref. Phytozome Gene 12:   19660889 UniGene:   At.38797
Omic ref. ePlant:   At3g17070 TAIR:   At3g17070
Protein sequence: AtPrx29 (At3g17070 / PER29 / AtperoxP29 / ATP40)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (311)
PWM (Da):   %s   36668.15 (33769.7)  
PI (pH):   %s   4.64 (4.50) Peptide Signal:   %s   cut: 29 range:29-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPKSKVAESTAASCFLVMSLLCSCIIGDQMETNNEGLSYSYYEKTCPKVEEIVRSSLSSMFILDPTSPAALLRLMFHDCQVQGCDASILLEPIRDQQFTELDSAKNFGIRKRDLVGSIKTSLELECPKQVSCSDVIILAARDAVALTGGPLISVPLGRKDSLSTPSKHVADSELPPSTADVDTTLSLFANKGMTIEESVAIMGAHTIGVTHCNNVLSRFDNANATSENMDPRFQTFLRVACPEFSPTSQAAEATFVPNDQTSVIFDTAYYDDAIAGRGNLRIDSEIGADPRTRPFVEAFAADQDRFFNAFSSAFVKLSSYKVLTGNEGVIRSVCDKVD

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns 1 and 3), 2 cDNA and 10 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTTCTCTCA TGTTTTTTCT TTTTATTGGT TCACAACTTC ACATTCGATG TACGTATTAC TAGTTTTCAA CGTATTAATG TAATTAAGTT AGCAAAATAT TTATTGTGTT TAGCTGTAAT  AAGGGTAGGA CCAATATATT CGTTTATAGA AAGGCTATAT TTTGTCCTTA ACGAATCCAC AAACCTCAAA CTTGACGAGG AACATAGGAA AAGAAACCTA TAACTTTGAT CAGTTTGATG  CTACTTTATT AGTATCCAAC AAAAAAAAAA AAACTATGCT TGTGGAAGTT TACCAGTTAC CACTACACTC TACACTCTAG TTGACATTAA ATTAAATTAA AGTAATTTTT CGTATTATAG  TTAAATTACT GCTGCATATA TTTTCACAAG AAAGCTTTAC GTTTTCTTAC CAACAAAAAA AAGCTTTACG TTTACTAATA TCACCACATT TATTACTCTT AACGGAGACT CTAGCTCCTC  AACTTGTGGA CCTTTGTATG TTATTGCGGA TCTAAAAGAA CACAGAGAAT TAAGAGAAAG CAATAGAGAG AGTTTTAGGA TGACGAAGGG AAATAGTGAA GTCACAGTGT TGATTCCACA  TTTGGAAAAC AGCTAGGGAC ATTAATTTCA CCGCAAATTC GTATTAATGA CTTCCACCAA TATTACTCAC TGGAGTCTCT AGAATCTCTA CTCGTCTTTT TCTACTAACC CTACACCTTT  GGGTCATTGG GTGTATATAT TTCTTCTGTT GGACTCTGTT TTCTCAATAT ATTGATAACT ATATTCCAAT TATTTATATC TTATAGCCTA TAGACTATAG ATAATGCTTA TCTGATTTTT  TATTTTATTT TCTGAAATAT GAACCCTCCA TTGACGATTG TAACAATGAA TGTTTTTTTT TGGGTCTAGC TAGGCCAATT TCTTTTTGCT ATTTTCTCAC GTTTTAGGCC AATGATTGAT  GATAAAAAAA AATATATATA TATATATATA TATTCACGTT TCACTTAAAT TTTAGAATAT TTTTTCTTTT CTACTTCTTT TAATTCAATT TAACCAAGCA TTCACATCAT CATATATATA  TATATATATA TATATATATG TATGTTGTTG AAATATTTAA TCAAGCATTA TTAGTTTATG ATAAATTAAA ATGCAGAAAA TTGAAATGTT ATTTTATAGT ATAAGAACAG TAATTAAAAG  AGAAGGCTAA AAAATCCAAA ATTTGATAAT ACATTAATAG ACATCATGTG GATAGATAAT ATATGTGTGT AGTATATGGA TGCAAACGTG AAAATCAACC TAACTGTTTC ACATTATCCA  TGCATGTTGC TTTTACCCAT TCTCTGTCTT GTCTTCTCCA TCAACTGTTA CCTATAACCA TTTATTGAAC CAAACCGGTC CACCGGTTCG CTACTTTTAT GTAAGCAAAT GCGTGATTTC  AATTCCCATG TACCGCAACT ATACTGAAAC AAAACAAAAC ACGAATTTTT TTTGGCTATT TCTCTACAAT ATAATTGAAA ACATATACTT TATCCAACAT CATATTAATA CAGATATATT  CGGTTCAGAA ACTGTTAACC AACTTTAACC GGAAATATAG TAGTCTTTAA ATTAGTATTG GTTGACTTTT TAATAACTAA TGTCACATCT CTTTAGCAAA ATTTTATAAA TAACGCATAT  AACATTAGCC ACATTAGTAA ACCTAGCAAT CTGGTTTCGT TTCGTATAAT GAGTCGAGAG GATGACTAAA CTCAACCCAA AAAAATCAAT AACCTATCGG TTAAAACTAG GTGGGATCTC  AAACCAATTT CATGTTTTAA AAATTCTTTT CGGTTGGGAT TATTAATGTC ACGAATTCAC GGGGACTTTC TTCAGCTTCC TATTTATACA TACACTTCCA ATTGCAAATA CACAAGTCAT 
CTTCTCTCTC TTTTTTTAGT GTGTGCAAAG TCATCTTCTC TTTTAATATT TACCTAAAAT TCCAAACAAA AGAGAAAGTT 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATATTTA TAATTATCAA ATGTTAAAAA TATTAAAAAA TATAATTAGT ATAAAATTAA AATAGCTTGA AGCATAGTAA CCGGACATAG TAAAACCGGG TTACAAAAGA ATTAACCATA  AACAATTTAC CGTTCTCAAA CACTCCTTGC CCAAAATTCA TTGGAGAATC AATTTTCACC CCATCGATCA GAATCATTCG AAATGATTAA TATCATTGAC GCACTACGAT GGTGGACCTT  ACGTCCTTGC CACAGTATAA CAAATTTTGA TTTTAACAAA TGGTTTAATG TCTTTTAATG AAATGCTACT TTTTGTTCCC CAGCAAAAAA AAACAAATGT AATATGCAAA TCTGATTTTA  TACAAAGAAG GCCCAATTTT TATATTTGCT TAAAAGACGC TACAACAGTT CAAAGCCGGT AACATTGAAT TCAATCCTCT TGCTGCCTAA TATATAGTGC TTCACTGGTT CGTTGTGTTT  TCTGTAAGTC CATCTTACCG TCTTAATTTT TTTTAAAGCC TCAGATGTAT GTCAATAATG CTGTAATTTT TTTCTTTTAA AACTACAGGA TTTTTTCTTC TTGTTTAAGT TGTAGTGTTG  AAGTTTTAGT TATATGAAAA CTAGACATTA TCGACAGAAA CTTCAAAAAC AAAAACACAA AAGATAAGTT TTAAAAATAA AATTATCAAG AATGAATAAA ATAATATATA CGATTTTTTT  TAATAACTAA TATAAGACAT TTTATTTACT TAAAAAAATA TTATAAATAT TATATTTACC ACTTATATTT TATTTTAAAA TATATACATA CAAAAACTTA CAGCTACAAC TAATTCATTT  ATACCAAAAA CTCTACAACA ACAAAAGCTA CGACAACAGT CAGCACTAAA AAACTACAGC TACAACCCAA CCAATCACCT AAATAGTTGT TTATCTTCTT GGATCAATTC TGATCATAAC 
AATTTATAGT TTACATATAT TTCTGAATTA TTTATAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCAAAGAGCAAAGTTGCAGAATCTACAGCTGCATCATGTTTTCTCGTCATGAGCTTGTTATGCAGCTGCATTATTGGTGACCAAATGGAGACTAATAATGAAGGCTTGTCTTAC
AGTTACTACGAGAAAACTTGTCCCAAAGTCGAAGAGATAGTGAGATCTTCACTTTCATCAATGTTTATACTTGATCCTACTTCTCCTGCAGCCTTGCTAAGGCTTATGTTTCATGACTGC
CAAGTTCAG
GTTCTCTACCTATAGCCAAATCCATCTCTCATTCTCTCTCTCTATAAGAAAATTCTCAATTTTTGTTTCCAACTCAATATAGGGTTAATTTGGTTTGAAAAGTGTTTATAT
ATTTCGGGATTCGAATTTATACATTTTGTGAATAAACATATCCATTAATTAGATATGATTACTCCGTCAATACATACGACAAATTGGACGTTCCGCGTTCGTACATGTTATGTGGTACGT
TTTTTCTAACATGAGCTTTCGTTTTTTTTTTTTTAATAAATAAACAAAAGCTTGAGACGTTTTATATATAATTTAAAATTTTTGGTAACTACGTAATTTCTCTTGCACGTGATCGATAAA
TTTAGAAGACAACAAGATGCGGAAATTTTTAATATTAAGAAAGTAAACAACATGCGGAAAATTTGCGAAGACCACTTTAATTAGTTAAAAAATGTTACGCCCCATTGTAGAATATATATA
TATATATATATGTATGTATGACGAATGAAGTAATTTTGTTTCATTTATCAGCGCCCATCATGTCATTTACAACATGGGATATAATGGTTTTGTGACTAAATTCATAGGCATGTTTTTTTA
TATAATAATGTTGTTATTTAACTTAAATTTATAGGCATTTGCCAAAATAAAATTATAAGCTAAATAGCAACATTATTATTTTGTTTTATTTGGTTTGATAAATATAGCAAAACTAATTTC
ATTATTCTGACACGTATGAAAAACAGATATAATGGTCGAGGATATATTGGAGATGATCACATGTTGTTAATCTGAGTTATACAATTTATGGATGAAAATAATAGATTAGACTAGGCACTT
GACCAAAAAAAAAAAAAAAGAGAGACTAAGCACATGCATGAAAATATTCACTGTTTTTTCTGATATAGATAAGTCACAAAATTTCGTTTCCATACTCTTTGAAAGAGATGGAGAAAAACT
CGAATTTGTTCTTCGTATTTATTCCATCTCATCATCATCATTAATTGTTGGGAACATGTTACATGTAACAGGGATGTGACGCATCAATCCTACTCGAGCCAATTAGAGACCAACAGTTCA
CCGAGCTTGATTCAGCCAAGAACTTCGGAATCAGAAAGAGGGACCTGGTTGGCTCTATCAAAACCTCACTAGAGCTTGAGTGTCCCAAGCAAGTCTCATGCTCTGACGTCATCATCCTCG
CCGCCAGAGACGCCGTGGCTCTCACGGGAGGCCCACTCATCTCCGTGCCATTAGGACGAAAAGACTCCCTCTCCACTCCAAGCAAACACGTGGCAGACTCTGAGCTTCCTCCCTCCACTG
CTGACGTTGACACTACCTTAAGCCTATTCGCTAACAAAGGCATGACCATCGAAGAGTCCGTGGCCATCATGG
GTATATAAACATTATTTATATCTTATATCTTATGCATATTTAATTCAT
AGAATAAGATTTCTTCGATCTCTTGTAGGTGCACATACGATAGGAGTCACACATTGCAACAACGTATTATCGCGTTTCGATAACGCAAACGCGACAAGCGAGAACATGGATCCACGTTTT
CAAACGTTCTTGCGTGTTGCTTGTCCAGAGTTTTCTCCAACTTCTCAAGCTGCGGAAGCCACATTTGTCCCCAACGATCAAACTTCGGTGATCTTCGATACAGCTTATTACGATGATGCC
ATCGCGGGACGTGGCAATCTTAGGATTGACTCGGAGATTGGAGCTGATCCACGTACACGTCCATTTGTGGAAGCGTTTGCAGCTGATCAAGACCGTTTCTTCAACGCCTTCTCTTCCGCG
TTTGTAAAATTGTCGTCTTACAAAGTGTTAACCGGGAATGAAGGAGTAATTAGAAGCGTGTGTGACAAGGTTGATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCAAAGAGCAAAGTTGCAGAATCTACAGCTGCATCATGTTTTCTCGTCATGAGCTTGTTATGCAGCTGCATTATTGGTGACCAAATGGAGACTAATAATGAAGGCTTGTCTTAC
AGTTACTACGAGAAAACTTGTCCCAAAGTCGAAGAGATAGTGAGATCTTCACTTTCATCAATGTTTATACTTGATCCTACTTCTCCTGCAGCCTTGCTAAGGCTTATGTTTCATGACTGC
CAAGTTCAG
GGATGTGACGCATCAATCCTACTCGAGCCAATTAGAGACCAACAGTTCACCGAGCTTGATTCAGCCAAGAACTTCGGAATCAGAAAGAGGGACCTGGTTGGCTCTATCAAA
ACCTCACTAGAGCTTGAGTGTCCCAAGCAAGTCTCATGCTCTGACGTCATCATCCTCGCCGCCAGAGACGCCGTGGCTCTCACGGGAGGCCCACTCATCTCCGTGCCATTAGGACGAAAA
GACTCCCTCTCCACTCCAAGCAAACACGTGGCAGACTCTGAGCTTCCTCCCTCCACTGCTGACGTTGACACTACCTTAAGCCTATTCGCTAACAAAGGCATGACCATCGAAGAGTCCGTG
GCCATCATGG
GTGCACATACGATAGGAGTCACACATTGCAACAACGTATTATCGCGTTTCGATAACGCAAACGCGACAAGCGAGAACATGGATCCACGTTTTCAAACGTTCTTGCGTGTT
GCTTGTCCAGAGTTTTCTCCAACTTCTCAAGCTGCGGAAGCCACATTTGTCCCCAACGATCAAACTTCGGTGATCTTCGATACAGCTTATTACGATGATGCCATCGCGGGACGTGGCAAT
CTTAGGATTGACTCGGAGATTGGAGCTGATCCACGTACACGTCCATTTGTGGAAGCGTTTGCAGCTGATCAAGACCGTTTCTTCAACGCCTTCTCTTCCGCGTTTGTAAAATTGTCGTCT
TACAAAGTGTTAACCGGGAATGAAGGAGTAATTAGAAGCGTGTGTGACAAGGTTGATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGTCATCTT CTCTCTCTTT TTTTAGTGTG TGCAAAGTCA TCTTCTCTTT TAATATTTAC CTAAAATTCC AAACAAAAGA GAAAGTTATG AAACCAAAGA GCAAAGTTGC AGAATCTACA  GCTGCATCAT GTTTTCTCGT CATGAGCTTG TTATGCAGCT GCATTATTGG TGACCAAATG GAGACTAATA ATGAAGGCTT GTCTTACAGT TACTACGAGA AAACTTGTCC CAAAGTCGAA  GAGATAGTGA GATCTTCACT TTCATCAATG TTTATACTTG ATCCTACTTC TCCTGCAGCC TTGCTAAGGC TTATGTTTCA TGACTGCCAA GTTCAGGGAT GTGACGCATC AATCCTACTC  GAGCCAATTA GAGACCAACA GTTCACCGAG CTTGATTCAG CCAAGAACTT CGGAATCAGA AAGAGGGACC TGGTTGGCTC TATCAAAACC TCACTAGAGC TTGAGTGTCC CAAGCAAGTC  TCATGCTCTG ACGTCATCAT CCTCGCCGCC AGAGACGCCG TGGCTCTCAC GGGAGGCCCA CTCATCTCCG TGCCATTAGG ACGAAAAGAC TCCCTCTCCA CTCCAAGCAA ACACGTGGCA  GACTCTGAGC TTCCTCCCTC CACTGCTGAC GTTGACACTA CCTTAAGCCT ATTCGCTAAC AAAGGCATGA CCATCGAAGA GTCCGTGGCC ATCATGGGTG CACATACGAT AGGAGTCACA  CATTGCAACA ACGTATTATC GCGTTTCGAT AACGCAAACG CGACAAGCGA GAACATGGAT CCACGTTTTC AAACGTTCTT GCGTGTTGCT TGTCCAGAGT TTTCTCCAAC TTCTCAAGCT  GCGGAAGCCA CATTTGTCCC CAACGATCAA ACTTCGGTGA TCTTCGATAC AGCTTATTAC GATGATGCCA TCGCGGGACG TGGCAATCTT AGGATTGACT CGGAGATTGG AGCTGATCCA  CGTACACGTC CATTTGTGGA AGCGTTTGCA GCTGATCAAG ACCGTTTCTT CAACGCCTTC TCTTCCGCGT TTGTAAAATT GTCGTCTTAC AAAGTGTTAA CCGGGAATGA AGGAGTAATT 
AGAAGCGTGT GTGACAAGGT TGATTGATGT ATATTTATAA TTATCAAATG TTAAAAATAT T 

Retrieve as FASTA