Entry information : LuRboh132(Lus10024683|PACid:23161549)
Entry ID 12200
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh132(Lus10024683|PACid:23161549)
Name LuRboh132(Lus10024683|PACid:23161549)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh132
start..stop
S start..stop
CsRboh01 1391 0 3..892 7..946
CclRboh01 1388 0 3..892 7..946
LuRboh159 1307 0 1..892 1..931
GmRboh17 1274 0 2..892 6..927
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 757844..758543 700 N° 2 758646..758805 160 N° 3 759005..759053 49 N° 4 759711..759824 114
N° 5 760666..761088 423 N° 6 761417..761605 189 N° 7 761881..761976 96 N° 8 762066..762181 116
N° 9 762282..762449 168 N° 10 762534..762693 160 N° 11 762797..762982 186 N° 12 763090..763297 208
N° 13 763398..763507 110  
join(757844..758543,758646..758805,759005..759053,759711..759824,760666..761088, 761417..761605,761881..761976,762066..762181,762282..762449,762534..762693,76279 7..762982,763090..763297,763398..763507)


exon

Literature and cross-references LuRboh132(Lus10024683|PACid:23161549)
DNA ref. Phytozome 11:   scaffold349 (757844..763507)
Protein sequence: LuRboh132(Lus10024683|PACid:23161549)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   893
PWM (Da):   %s   100861.55 Transmb domain:   %s   o400-419i536-558o
PI (pH):   %s   9.46
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKHERRWRSDSLPGKGRAADSSSSSSAGTSPASDARSSTAAATEDFVEVTLDLQDDDTIILRSVEPATVINIGGEEGDHESGGSELLPRSTPTSAPTSRSPTIKRSSSNKLRQFSQELKADAVAKARQFSLDVRAELRRFSRSRGGTASRNNNPENNNNGGAVFESALAARALRKQRAQLDRTRTSAHKALRGLKFISKRKSQGVEAWNEVASNFDKLAVDGYLQRADFAQCIGMRDSKEFALELFDGLSRRRRLKVEKLSKEELYEFWAQITDDSFDSRLQIFFDMVDKNEDGRLTEEDVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYQNYSQAMSYTSQALSQNLQGLRMRSPIRRMSTNFVYFLEMNWKRIWVISLWIMIMIGLFAWKFYQYKQKAAFNVMGYCLLTAKGAAETLKFNMALILLPVCRNTITRLRSTRLAYVFPFDDNINFHKTIAAAIVVGVILHVGNHLACDFPRLESASAHDYDLYLRKDFGDHKPSYMKLVRGVEGVTGILMTWMYLSVPVLLYAGERALRFFRSGSHSVRLLKVAIYPGNVLTLQMSKPTQFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSVHIRQLGDWTQELKRVFSEVCERPISGKSGLLRADETTKRSLPKLLIDGPYGAPAQDYKKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEMDSVADSSRGSDQLSFTSTTDFMRRKKALIKTTNAYFYWVTREQGSFDWFKGVMNEIADLDQRGVLEMHNYLTSVYEEGDARSTLITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLSKLSSKHCNARIGVFYCGAPVLANELGKLCYEFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCACGAGAGGCGATGGCGATCGGATTCCTTACCTGGAAAGGGCAGAGCAGCTGACAGCAGTAGCAGCAGCAGCGCGGGGACTTCTCCGGCGAGCGATGCGAGAAGCTCGACAGCG
GCAGCGACGGAGGATTTCGTCGAGGTCACGCTCGATTTGCAGGACGACGATACGATTATACTCCGAAGCGTTGAGCCGGCGACGGTGATCAATATCGGCGGAGAGGAAGGCGATCACGAG
AGCGGCGGAAGCGAGCTGTTACCTCGTTCGACTCCTACTTCCGCTCCGACTTCCAGATCTCCTACGATCAAGCGAAGCTCGTCAAACAAGCTGCGGCAGTTCTCGCAGGAGCTGAAGGCG
GATGCAGTGGCGAAGGCGAGACAATTCTCGCTGGATGTGAGAGCTGAGCTACGTAGGTTCTCGAGGAGCCGCGGAGGAACAGCGTCGCGTAATAATAATCCGGAGAACAACAACAATGGC
GGTGCTGTATTTGAGTCCGCGTTGGCTGCTCGAGCTCTGAGGAAGCAGCGAGCTCAGCTCGATCGGACCAGGACCAGCGCTCACAAAGCCCTGCGGGGTCTCAAGTTCATCAGTAAGAGG
AAATCTCAAGGCGTCGAGGCGTGGAATGAAGTGGCCAGCAACTTCGATAAGCTCGCCGTGGACGGTTATCTCCAACGCGCAGATTTCGCGCAATGCATAG
GTTAGTTTTTAAATCCCTAA
TCACGTCGACATTTCAGTTTTTTTCAATTCGATTTGGATAATTTCGTCTGGTGAATTGATTTTGTAAAGTTCTCCCCTGTAGGGATGAGAGACTCTAAAGAGTTTGCACTCGAACTGTTC
GACGGATTGAGCAGGAGAAGGAGGTTGAAGGTTGAGAAGCTTAGCAAGGAGGAGTTGTACGAATTCTGGGCACAAATCACCGATGACAGCTTCGACTCACGGCTTCAGATCTTCTTCGAC
AT
GTATGCAGAAAAGCACAAACCAATGATGATTGATCAATTTAGACTAGTTGATCGCCTCCTTAATTAATTAATTAGTCAATACTGATTTGGTATTAGCCGTTTGACAAGACAAAATCGT
CCTTTCTGACGTGTCCATTTCTTATTGCTCTACGTTTCGGATGCTTGTGAGTTTTCCTAACAGTAATGCTTATTGTAACAGGGTGGACAAGAATGAAGATGGTAGACTCACAGAGGAAGA
CGTAAAAGAG
GTACCTGCAGTTTCTTGTTTATCTTATCAATTCTTGTATAATAATCATTGAAAGAATCAGTCTACATTACTGTTGTGATTTTCATGGTTAACTTAAAGGTCTAAGCCTAG
AGTCGTGAATTAGTCAATTAGGCACCACTACCCTGTCAATTGCTTGAGGAAGAAACTAACTCATCAATATTTTAACCAGCCATTTTAGCAGCCGTCTATCCCCACAGAAGTGTCGTAGGA
CTTTTTTATAAAGTAAGCAATTTGGCTTTATTATTGATATCTTACTGAAGAGGGTAGGCTTGAAATTTGCATCAAATTTAAATTCCCAGGACTAACTGCTCCATTACTGCAATGAAACCA
TATTGTGTTGTTTCCACGATTCGTTTGTTTATCAAACGATTCCATTATATATAGTGACGTTCCCTATATTCTGACTTCTGAAATATTATCTTTGAATTGTTGGACTGGATCTACTCCTCT
TAGTAAAAGGGGTTTGGAATTGGGTTGACAACGTTTGGCATTTTTTTATGTTCCAACTTCCGAACGTAGCGTCAGGAAGTTTACATGTCATTTTGTTGTTTGGGTTAGGTAGGAGGCTTT
ATTCGTTCTTGTGTTTTTACCTTTTTTCTTACTAATTACTGACTTTCTATTCTCTGTACTTTTATAGATTATTATGTTAAGTGCTTCGGCGAATAAACTATCAAGATTGAAGGAACAAGC
GGAAGAATATGCAGCTTTGATCATGGAAGAGTTGGACCCTGAAGGACTTGGCTACATCGAG
GTGGGTCCTAGTCCTACATTTATGTGTTCACTTACGTTGATTCTTGTGCTAGAAGCAAT
AGCGTTAAACTGCATTGACATATAATTATAAGTCTTAAACAAGAATATTATTCAAGTAAGGAGTCATTTTCAGTCTAGTTTTCACATACTAGTTAACTGCTCTTTGCGGGGAGGTTGTTA
GGCTAAATACATGTTTAATGAAAGCCAAGTCTGACCATTCTTTAGATTCTTAATCAATTACCAAACAAGAATCGGTTACAACATTTCTATCATGATGCTTCTTCTTTCAAAGTCCATGAA
TTGTTAGGCAAAAAACAATGAGATAGATAAGTCATCGAGAATTGGGGTTGTGATGTTGTTCAACTGTGAACGAAGAAAAAAAAGATGATGAAACAAGTGGAGAAGGATCATTAATTTGGT
TAAGTAAACTTATCTAAGTGGATTTCTCGTTGTCGGTGGTTCAACAGCTTTCCTAGTTGTTGCTTATTTTTCCATCTTTCCGCCTTCCCATAACCTGCTCTACTATTTTTAGTTGATTGT
CATGTTATTGTGGCATGATTAGCTAGTGAACAGTATATAAAATATTAGCATACGCTAGTGACATAACATGGTCTGTCAAATTGTCAATTGGGTATGGAGGGAAATCTAGCTAGAGAGTAA
ATGCCATTGATTGTTGAGAAATTCTTGCGACTCATAAAACATAATTGAACAAAAATACTGATCACATCATAGCTTCAGTACTTTTGGAGAGAAAATCGTTTCATCTCCAGTACTTTTACT
GGCCTAGTTGCAGTGACCGAGAGATACCATACCATAGTCCTAAGTTGATAATGATACTGCAGCTATGGCAACTGGAGACGCTTCTTCTACAAAAGGACACATATCAAAACTACAGTCAAG
CAATGAGCTACACAAGCCAAGCCTTGAGCCAGAACTTGCAAGGGCTAAGAATGAGAAGCCCAATAAGGAGGATGAGCACAAACTTTGTCTACTTCTTGGAAATGAACTGGAAGAGGATCT
GGGTGATATCCTTATGGATCATGATCATGATTGGACTGTTCGCATGGAAATTCTATCAGTATAAGCAGAAAGCTGCCTTCAATGTCATGGGTTACTGTCTCCTGACGGCAAAGGGTGCTG
CGGAAACTCTGAAGTTCAACATGGCCCTCATTCTGCTTCCCGTGTGTAGAAACACCATCACTCGGCTCAGGTCCACACGTCTGGCTTATGTTTTCCCTTTCGATGACAACATAAACTTCC
ACAAG
GTACATTTTCCTAATTTCACCAACCCCCTTTTCTTCCGTTAGTCTTGCTGAAACTGCTTTACTTGTTTAGTACGTTAATCAAGTGGGGTCATATCATGGAGACTTTATTAGACAG
TACTATGATGGTTGATCTTATATCCGTGTAGTTCGATGATGTTACTGTTCCAAAAGTTAGTGATCACTTTATTCCAAGGAAGAAAGACAAAAAGGAAAAGCTTGCTCAGTTAATTTTACG
ACTTCTTAGGCTAAACAGATAGAACAATCAGTATATTGCATCGAAACAGGCATTGACAAAACTGTACTTGGCGTTCTTCCTTTATGTCTGCAGACTATTGCGGCAGCAATCGTAGTTGGC
GTCATCCTTCACGTTGGAAACCACCTTGCCTGTGATTTCCCGAGGCTCGAAAGCGCTTCTGCCCATGACTACGATCTGTATCTCAGAAAAGACTTCGGAGACCATAAACCCAGTTACATG
AAATTAGTTAGGGGGGTAGAGGGCGTGACTGGAATCCTGATG
GTAATTTTCATGGCAATTGCATTCACCCTGGCAACGAGATGGTTCAGGCGTAACCTCATTAAGTTTCCCAAACCGTTT
GACAGAATCACTGGGTTCAATGCCTTCTGGTATTCACACCACTTATTTGTCCTCGTCTATATATTGCTGGTCGTCCATGGTATATTCCTCTACCTGGTTCATCACTGGTATAAGAAAACG
GTAAGGTTCCCAATATTGCTTCCTTCCCTTTCAATAGATTCATCGTTCCATTTAGGACGTTTTTACATTCCCGGCAGACATGGATGTACCTCTCTGTTCCTGTGCTGCTTTACGCCGGAG
AAAGAGCCCTCAGGTTCTTCCGCTCTGGCTCCCATTCAGTCCGGCTTTTGAAG
GTTAGTTAGCAGCCTATTAATAGTGTTATATGATTGCCCAAAGGATCTGTCTATAAGCTATTTACCA
TTGTTGATATATGCGTTTCCAGGTTGCAATTTACCCTGGCAACGTACTCACATTGCAAATGTCAAAGCCTACTCAATTCCGGTACAAGAGCGGGCAGTACATGTTCGTTCAGTGCCCTGC
TGTTTCTCCATTTGAATG
GTAAAATACTCTGCTTTTTCTTCTGTTGCCTTTTTTCTCTTCTCTTGTTCTGTCATAATCTTAAGACTTATATCTGATTCAATTATCAATTTCTCCCCAGGC
ACCCATTCTCGATAACTTCAGCTCCTGGAGATGACTACCTTAGCGTCCATATCCGACAGCTAGGCGATTGGACACAAGAACTGAAAAGGGTATTCTCTGAGGTCTGCGAGCGTCCTATTT
CTGGCAAAAGTGGCCTTCTTAGAGCTGATGAAACCACCAAGAGAAG
GTGATTAGCTGAATCTGGTCAACATTTCCTTTCTTTATTTTTCTCTGCACAATGGTGAATCATTTGCTATGTCC
GATTATACAGTTTGCCGAAGCTGTTAATAGATGGGCCGTACGGTGCCCCAGCGCAAGACTACAAGAAATACGACGTCTTGTTACTCGTAGGGTTGGGTATCGGAGCAACGCCTTTCATCA
GCATTCTCAAAGACTTGCTTAACAACATCGTCAAGATGGAGGAGATGGCT
GTAAGTAAACTACACTAGAAAAGGAAATAAGAAAAAAATGGACTGAATCTGTTTCCATTCCAACTAACAT
TCATAGCCACATTAATTCTTCATGTTTGTGCAGGATTCCGTAGCGGACTCCAGCAGAGGTTCAGATCAGCTGAGCTTCACGAGCACCACCGACTTTATGAGACGGAAGAAGGCATTGATA
AAAACCACAAACGCTTACTTCTACTGGGTAACAAGGGAACAAGGCTCATTCGATTGGTTCAAAGGCGTGATGAACGAGATTGCCGACCTTGATCAGAGG
GTACGTAAGAATTAGTACATA
ACACACACAAATGCTGCTATACCTTAGTCATTGGATTTGGCTACTTACCTGAGAAAAGAATGGAATTGGTGTGTTAATCAATCCAGGGGGTACTTGAGATGCACAACTACTTAACCAGCG
TATACGAGGAAGGGGACGCGAGATCGACTCTGATAACGATGGTGCAAGCATTGAACCATGCCAAAAACGGAGTGGACATTGTCTCGGGGACTAGGGTGCGAACTCATTTCGCGAGGCCTA
ACTGGAAGAAGGTGCTCTCAAAACTAAGCTCAAAGCACTGTAATGCAAGGATAG
GTAAACGCATCAATCTCTTTTTTCCTCTATATACTTCCCCAGTTAGTCATGTTTGATCTGAAAAGG
GTTTTGATTATTGATGTTCTGGTGGGGAATGCAGGGGTATTCTACTGTGGGGCACCAGTTCTGGCCAACGAACTCGGAAAGCTATGCTACGAGTTCAACCAGAAGGGTTCTACCAAGTTC
GAATTCCACAAGGAGCATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCACGAGAGGCGATGGCGATCGGATTCCTTACCTGGAAAGGGCAGAGCAGCTGACAGCAGTAGCAGCAGCAGCGCGGGGACTTCTCCGGCGAGCGATGCGAGAAGCTCGACAGCG
GCAGCGACGGAGGATTTCGTCGAGGTCACGCTCGATTTGCAGGACGACGATACGATTATACTCCGAAGCGTTGAGCCGGCGACGGTGATCAATATCGGCGGAGAGGAAGGCGATCACGAG
AGCGGCGGAAGCGAGCTGTTACCTCGTTCGACTCCTACTTCCGCTCCGACTTCCAGATCTCCTACGATCAAGCGAAGCTCGTCAAACAAGCTGCGGCAGTTCTCGCAGGAGCTGAAGGCG
GATGCAGTGGCGAAGGCGAGACAATTCTCGCTGGATGTGAGAGCTGAGCTACGTAGGTTCTCGAGGAGCCGCGGAGGAACAGCGTCGCGTAATAATAATCCGGAGAACAACAACAATGGC
GGTGCTGTATTTGAGTCCGCGTTGGCTGCTCGAGCTCTGAGGAAGCAGCGAGCTCAGCTCGATCGGACCAGGACCAGCGCTCACAAAGCCCTGCGGGGTCTCAAGTTCATCAGTAAGAGG
AAATCTCAAGGCGTCGAGGCGTGGAATGAAGTGGCCAGCAACTTCGATAAGCTCGCCGTGGACGGTTATCTCCAACGCGCAGATTTCGCGCAATGCATAG
GGATGAGAGACTCTAAAGAG
TTTGCACTCGAACTGTTCGACGGATTGAGCAGGAGAAGGAGGTTGAAGGTTGAGAAGCTTAGCAAGGAGGAGTTGTACGAATTCTGGGCACAAATCACCGATGACAGCTTCGACTCACGG
CTTCAGATCTTCTTCGACAT
GGTGGACAAGAATGAAGATGGTAGACTCACAGAGGAAGACGTAAAAGAGATTATTATGTTAAGTGCTTCGGCGAATAAACTATCAAGATTGAAGGAACAA
GCGGAAGAATATGCAGCTTTGATCATGGAAGAGTTGGACCCTGAAGGACTTGGCTACATCGAG
CTATGGCAACTGGAGACGCTTCTTCTACAAAAGGACACATATCAAAACTACAGTCAA
GCAATGAGCTACACAAGCCAAGCCTTGAGCCAGAACTTGCAAGGGCTAAGAATGAGAAGCCCAATAAGGAGGATGAGCACAAACTTTGTCTACTTCTTGGAAATGAACTGGAAGAGGATC
TGGGTGATATCCTTATGGATCATGATCATGATTGGACTGTTCGCATGGAAATTCTATCAGTATAAGCAGAAAGCTGCCTTCAATGTCATGGGTTACTGTCTCCTGACGGCAAAGGGTGCT
GCGGAAACTCTGAAGTTCAACATGGCCCTCATTCTGCTTCCCGTGTGTAGAAACACCATCACTCGGCTCAGGTCCACACGTCTGGCTTATGTTTTCCCTTTCGATGACAACATAAACTTC
CACAAG
ACTATTGCGGCAGCAATCGTAGTTGGCGTCATCCTTCACGTTGGAAACCACCTTGCCTGTGATTTCCCGAGGCTCGAAAGCGCTTCTGCCCATGACTACGATCTGTATCTCAGA
AAAGACTTCGGAGACCATAAACCCAGTTACATGAAATTAGTTAGGGGGGTAGAGGGCGTGACTGGAATCCTGATG
ACATGGATGTACCTCTCTGTTCCTGTGCTGCTTTACGCCGGAGAA
AGAGCCCTCAGGTTCTTCCGCTCTGGCTCCCATTCAGTCCGGCTTTTGAAG
GTTGCAATTTACCCTGGCAACGTACTCACATTGCAAATGTCAAAGCCTACTCAATTCCGGTACAAGAGC
GGGCAGTACATGTTCGTTCAGTGCCCTGCTGTTTCTCCATTTGAATG
GCACCCATTCTCGATAACTTCAGCTCCTGGAGATGACTACCTTAGCGTCCATATCCGACAGCTAGGCGATTGG
ACACAAGAACTGAAAAGGGTATTCTCTGAGGTCTGCGAGCGTCCTATTTCTGGCAAAAGTGGCCTTCTTAGAGCTGATGAAACCACCAAGAGAAG
TTTGCCGAAGCTGTTAATAGATGGG
CCGTACGGTGCCCCAGCGCAAGACTACAAGAAATACGACGTCTTGTTACTCGTAGGGTTGGGTATCGGAGCAACGCCTTTCATCAGCATTCTCAAAGACTTGCTTAACAACATCGTCAAG
ATGGAGGAGATGGCT
GATTCCGTAGCGGACTCCAGCAGAGGTTCAGATCAGCTGAGCTTCACGAGCACCACCGACTTTATGAGACGGAAGAAGGCATTGATAAAAACCACAAACGCTTAC
TTCTACTGGGTAACAAGGGAACAAGGCTCATTCGATTGGTTCAAAGGCGTGATGAACGAGATTGCCGACCTTGATCAGAGG
GGGGTACTTGAGATGCACAACTACTTAACCAGCGTATAC
GAGGAAGGGGACGCGAGATCGACTCTGATAACGATGGTGCAAGCATTGAACCATGCCAAAAACGGAGTGGACATTGTCTCGGGGACTAGGGTGCGAACTCATTTCGCGAGGCCTAACTGG
AAGAAGGTGCTCTCAAAACTAAGCTCAAAGCACTGTAATGCAAGGATAG
GGGTATTCTACTGTGGGGCACCAGTTCTGGCCAACGAACTCGGAAAGCTATGCTACGAGTTCAACCAGAAG
GGTTCTACCAAGTTCGAATTCCACAAGGAGCATTTCTAG

Retrieve as FASTA