Entry information : LuRboh159(Lus10028755|PACid:23177288)
Entry ID 12201
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh159(Lus10028755|PACid:23177288)
Name LuRboh159(Lus10028755|PACid:23177288)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh159
start..stop
S start..stop
LuRboh230 1733 0 1..931 1..904
PtRboh03 1580 0 2..931 7..948
PtRboh02 1569 0 2..931 7..949
LuRboh178 1564 0 1..931 1..963
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 86210..86882 673 N° 2 85903..86062 160 N° 3 85596..85644 49 N° 4 85027..85140 114
N° 5 82364..82786 423 N° 6 81432..81818 387 N° 7 81172..81347 176 N° 8 80608..80775 168
N° 9 80341..80500 160 N° 10 80091..80258 168 N° 11 79872..80000 129 N° 12 79695..79773 79
N° 13 79484..79593 110  
complement(join(79484..79593,79695..79773,79872..80000,80091..80258,80341..80500 ,80608..80775,81172..81347,81432..81818,82364..82786,85027..85140,85596..85644,8 5903..86062,86210..86882))


exon

Literature and cross-references LuRboh159(Lus10028755|PACid:23177288)
DNA ref. Phytozome 11:   scaffold540 (86882..79484)
Protein sequence: LuRboh159(Lus10028755|PACid:23177288)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   932
PWM (Da):   %s   106021.71 Transmb domain:   %s   o391-409i530-552o572-594i739-756o
PI (pH):   %s   9.85
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRHERRWGSDSVPARGATASSSSAGTSRGSSMTGEEFVEVTLDLQDDDTIILRSVEPATVINIAGGSDSEGGRELVADNSTPDSAPASRSPTIKRSSSNKLRQFSHELKVEAVAKARQFSQELKAELRRFSWSQGLSSRNSPMNNNNGGAAAGFDSALAARALRRQRAQLDRTRSGAQKALRGLKFISNRKSQAAVDAWNEVHSNFEKLAKDGYLYRADFAQCIGMKDSKEFAVELFDALGRRRRLKVEKISRDELYEFWSQITDDSFDSRLQIFFDMVDKNEDGRITEEEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPERLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRRRSPIKRMSTKLVYFLEENWKRIWVVSLWIMIMVGLFTWKFHQYKQKAAFKVMGYCLLTAKGAAETLKFNMALILLPVCRNTITRLRSTRLAFLVPFDDNINFHKTIATAIVIGVILHVGNHLACDFPRLEGSSLQDYNRYLRNDFGHHKPSYWKLVRGPEGVTGILMVICMIIAFTLATRWFRRSLIKLPKPFDRLTGFNAFWYSHHLFVSVYILLVVHGEYLYLVHHWYKKTTWMYLSVPVFLYAGERALRFFRSGSHTVRLLKVAIYPGNVLTLKISKPPQFRYKSGQYMHPFSITSAPGDDYLSVHIRQLGDWTQELKRVFSEACERPVSGKSGLLRADETTKKSLPKLLIDGPYGAPAQDYRKYDVLLVVGLGIGATPFISILKDLQNNIVTMEEQDSLTDVNRASEQSFDATRRKKALKTTNAYFYWVTREQGSFDWFKGVMNEIADHDQRGVIEMHNYLTSVYEEGDARSTLITMVQALNHAKNGVDVVSGTTVRTHFARPNWKKVLSKLSSKHCNARIGVFYCGAPVLAKELGKLCYEFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCACGAGAGGCGGTGGGGATCCGATTCTGTGCCGGCAAGGGGGGCGACGGCTAGCAGCAGCAGCGCAGGGACGTCTCGGGGGAGTTCGATGACAGGGGAGGAGTTCGTCGAGGTC
ACGCTTGATTTGCAGGACGATGACACGATTATCCTCAGGAGCGTTGAGCCGGCGACAGTCATTAACATCGCCGGCGGGAGTGATAGTGAAGGCGGAAGGGAGTTGGTTGCAGATAATTCA
ACTCCTGATTCGGCTCCGGCTTCCAGATCGCCGACGATCAAGCGGAGCTCGTCAAACAAGCTGCGGCAATTCTCGCACGAGCTGAAGGTGGAGGCGGTGGCGAAGGCAAGGCAGTTCTCT
CAGGAGCTAAAAGCGGAGCTCAGGAGGTTCTCCTGGAGCCAAGGACTGTCATCTCGCAATTCGCCAATGAACAATAATAATGGCGGTGCAGCTGCTGGATTCGATTCGGCGTTGGCTGCT
CGAGCTCTGAGGAGGCAGCGAGCTCAGCTCGATCGGACCAGGTCCGGAGCTCAGAAGGCGCTTCGCGGTCTCAAATTCATCAGTAACAGAAAATCGCAGGCCGCTGTGGATGCGTGGAAC
GAAGTCCATAGCAACTTCGAGAAGCTTGCAAAGGACGGTTATCTCTACCGCGCCGATTTCGCACAATGCATAG
GTTCTCCGATCGATTTCCCCCCCTTCTCTGTCTCATCATCGGCTTTC
CCCAATTAGTCAAACATTTCAAAATATGCTTTTAGGTCTCAACTACTCCTTCAAATATTTTTTATTTGGTTGCTTAGTTATTACGTCTCTTGGATTGAAGGGATGAAGGACTCCAAGGAG
TTTGCAGTGGAACTGTTCGACGCATTGGGGAGGAGAAGAAGGCTGAAGGTGGAGAAGATTAGCAGGGACGAGCTTTACGAGTTCTGGTCACAAATCACCGATGACAGCTTCGATTCACGC
CTCCAGATCTTCTTCGACAT
GTACGCTTCAAAACAAAATTCAAATGATTACTAAAAATATTCAATTTTGGATTTTAGCAAACTGTTCTTAATTAGTTTTATCATACATATCCCACTCCCT
CCTCACAGTACAGTTCTTAGTTGTTGCATATAGAAACGATTATTAATTTTTGCAGTGAACAGAGGTCAACATTGTCATTCCAGCTTTTTTTTTCTTATTTCTGACTTTGAGTCGATAAGT
TGATCTTTGATTCGGTAATCCTTTTTGGTGATGAACAGGGTAGACAAGAATGAAGATGGCAGAATTACAGAGGAAGAAGTAAAAGAGGTACGGGCACCTTTTAAAATTACCGACTGGCAT
CATCCTTTTCTCTTAACGAATATTACGCGCTATCATGGTTAATTACTTAAATTTGATGGTTTGTTTAAGCCTAATTGCATCAATTAGTCAATTAGCAGCCAACGCCCTGTCAGATTCTAC
TGAGAAATGAAAACTTACGCGCCGACCCATTCCTTGAAAAAAGACGAACCCCGAAGAGTATTTTAAGTAACGTTTTGTTCATATAGGAGGGATTAGCAGTCGCAGCGATTTACAGGCTAA
TTGGTTGAAACCCTACAGGTTGTCATTTGGCATCACTATTTATAATACAATGTTCCAGGGTGGGGGAGGATTCGTTGGCCTTTGAAAATTCCATCACATTCCCACATCACTAACTACTCC
CGTCCAACCAACGTACACTCATAATGAAATTATAGCCCCTCTTCTGTTTTTTTTTTCTTCAGATTATTATGTTGAGTGCCTCCGCAAACAAATTATCCAGATTGAAGGAACAGGCAGAGG
AATATGCAGCACTGATCATGGAAGAGTTGGACCCCGAAAGACTTGGCTACATCGAG
GTGGGTCCAATATTTGCTTTGTCTTTTTACTACTCATACGATTTCTTATATTAAGGAAATAGCA
GTTTACTACAAAACCATACATCAATTTAAACTAAAGGGAAAACGAATTCTTGACATAAAAAGGACAGTAATTTACTATGAAATTAATTAATTAATTATCAATTAAGGATTGTTAGTTACA
GTATCTCTACGACCCTGCAGTCACGCTGCCTCTTCGTTCAAAGTCCAATTAATGTTAGGCCAAAATAGGAGTAATAAATTCACTCAAGAATGGAGGCTGTTCAAGTAAAGATGATTTATT
TGGTTAAGTAAAGCTAATCTAAGTGGAGTTGTATCTTTAGTGGTTGAACAAGCTTCCAGTGAGTTTTATATTTCACGTTTTACATCATTTTATACTCTTACTAACTATACAATAGTATGG
TGTAAAACTGTAAATGCCATTATTTGACCGACGGTTGAAAATGAAGTAACTCATTTTGTACACGAAGATAAAACGTTAATCGTCAAATATTTAATCTTACCCAGTTCCAGGAAGAAAACA
GCGTACCAACTACTAGTCTAAGAGCATTTTCATACTTCATTTTTTAGTTATTGCTAAATTGCTAAATAATGTAAATTGTGTAACGGTATCTAATAAGAAATTGTTTTAAATAGAGAAGTG
TTTGCTAAATTAGCAAGTATATTAGTACTACCACATAAGCTTAGAGCTGTTTATGAACCAAACCGAGTCGAACTTTGATGTGCTCGATCTTGGTTTGGTACGTTTTAGGCGAGCTCGAGC
TTGAACCCGAGCTAGAAAATTTTGGATTGTCACAAGTTCGAGCCTGACTTGTTAACTATATTTGACGAGCCAAACTCGAGATTAATTCGAATTTTGCGTCATAAAAAACTGTCAATGAGT
CTATTTTGAACTAATTTTGAAGCTTGTAAACTAAAAAATATCGACGAGTCAAGTTAAAGAAGAAGATATCATAAAACTTATAATTTTTTATTTTTCTCAATTAAAAGAGTTAAATCTAAA
TAATATATCACTTGTATTTTCATTAGCACAATCCCAAATTAAATATAATTTATTGTATATGGTTTTCGAGGCAAAACACATGTCGCATTATTGAGTCTATTAACGAGCTATATACTCGAG
TTAGTATTCGAGTTGAATCTCAAGCTCGAGCTCAAGCACGCGTTGCCGAGTGGGCCATACCGTGGCTCAAACTTGTCTTGTTTAAAATCGAGCCGAGTCACGAACGAACTTTTTCCAAAC
CGAACGCCGAGCTGCTCACGAGCGGTTTGATTCGTCAACAACCTACATAAGCTACATAGCTACGAGGAAAATCATTTATGATATAAAAATAAATCAATTAAATCTAGTCTTTTATTTCTT
ATTCTCTAAATTTTTTATCATTTGTTTATATAATTTTAATTATTTTTAATATGAATATGGTTATATTTTATATTAAAATTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
CTAATGAATTGCTGAGATGGAGATGATCTAATTCCCTAGCATGCTCAGCCCGAATTTGGAGTCAGAGAAATGATGTTTTAATCCAATCTAAAAAGCCCGCACGAAACTCAACCGTTTAAA
AATTGTGTCTTCTAATCACTTAAAATATGGGGACAAAATTAACATTTCACAACCATACAAATGTGTATATTAAGTATATAATAATATTTTGTACAATATTTAGTATTACACTTTGTACAA
AAGCCATACAAATATATATACACTTTTGTACGGATTTGTATAAATCTATACACATTTGTATGATCCATACGATTCACTATATAAAGTTGTACGACCGGTCGTCGAAAAATATTTCCAGAA
AAAAGAATTCCGAAAAACTTAGTGCAAAAATATTCCTAATTGAAAGTCAGAATCGGCAGCAAATTAATTATAAAACTTTCCAATAACCGAAGATGGTAATTTAGCCACCGGAGACCGGAG
AGGGTGATTCTGCCGGCTATTTTCTACCCTTTACATGATTGGCGCTGAATTAATTGAATCCTCTGCAACTGTAGTGGATGAGTGTAACGAACTGCACACTCATGATGGATACATTGAACT
CATGCATATTCCTGCCACGTTGGTGCCCATGTGGACGGCTGATCAGGCCGCATCCCTCTTTGTGCGCTGGGTCTTGTCTTATGCATTTGTCTGCCAATGATAGTGCACATAACTCTCGTC
ACCTGCAACAATGCAGTTATGGCAACTGGAAACGCTTCTTCTCCAGAAGGACACGTATCTAAACTACAGTCAAGCACTGAGCTACACGAGCCAAGCACTGAGCCAGAACTTACAAGGGCT
AAGAAGGCGAAGTCCAATCAAGCGGATGAGCACAAAGTTGGTCTACTTTCTGGAAGAGAACTGGAAAAGAATCTGGGTGGTGTCACTATGGATCATGATCATGGTCGGGCTATTCACATG
GAAGTTTCATCAGTACAAGCAGAAAGCCGCTTTCAAGGTTATGGGTTACTGTCTCCTCACGGCAAAAGGCGCAGCGGAGACTTTGAAGTTCAACATGGCACTCATTCTCCTCCCAGTCTG
TAGAAACACCATCACTCGCCTCAGGTCCACACGGCTGGCTTTTCTTGTGCCTTTCGACGACAACATCAACTTCCACAAG
GTACGTGCACGTCCTCCTCGTCGTTTCACCAACCACGTACC
TTTTGATTCCTGTTACTTGCTTAAACTTGCTTGCTTATTTTGGACGTTAGAATCAGTGGGGTCTTATCGTGGAAGACTTTATTAACAAAAAAAGTCAATAAGATGGTTGTTCTTATATAT
AGGCATACTCTTTGGGAATATTTCTTTTCGTTAGGTGCGCACTCAGAGTATATTTATGGTCGTATCCGTGTGGTTAGATAACGTTACCCATTTTCTTGCTCGCTGGACCACGTAGAAAAA
ATTGACAGTCACTTTGCATGATTAAATACAGAGAGATATACAGAGGAATTTGCAGCGAAACTGTAACACAGTCCATCAAATAGGATACTTTTGCCGTCACAGCTTCACCAATTGTCCGCA
CTAACTTTTTGATGGAAGGAAAGGAGATTAAATTGTACAGAAAGAAAATGTGAGAATTTTTTTTCTCGGAAAGCCAGATTGATCAACTAATAAATTGAAGTAAAAATCAATTGCTAATGT
TGTTTTGATTATGCGTATGTGCAGACTATTGCGACAGCAATCGTGATTGGTGTTATTCTGCACGTTGGAAATCACCTCGCCTGCGATTTTCCAAGGCTCGAGGGCTCGTCTCTGCAGGAC
TACAATCGGTACCTTAGAAATGACTTTGGACACCATAAACCCAGTTACTGGAAACTGGTTAGAGGGCCAGAAGGTGTCACAGGGATTCTGATGGTGATTTGCATGATAATTGCGTTTACA
CTGGCAACCAGATGGTTCAGGCGTAGCCTTATTAAACTACCTAAACCATTTGACAGACTCACAGGATTCAATGCCTTTTGGTATTCACACCATCTATTCGTCAGCGTCTATATCTTGCTC
GTCGTCCATGGAGAATACCTCTACTTGGTCCATCACTGGTATAAAAAAACG
GTATGGTTCAGATTATTTGTCCCCTCATACTATAGAATCAATCAACTTCGTTTTATATACTCTTAACGA
TTACAATCCCAACAGACCTGGATGTACCTCTCTGTTCCTGTGTTTTTGTACGCTGGAGAAAGAGCTCTCAGGTTCTTCCGCTCTGGCTCCCATACAGTCCGGCTATTGAAGGTTGCAATT
TATCCTGGAAATGTGCTGACCTTAAAAATTTCCAAGCCTCCTCAGTTCCGGTACAAGAGTGGGCAGTACAT
GTTCGTTCAATGTCCAGCAGTCTCTCCATTTGAATGGTAACTGATGATC
TTAATTTTGATCTGGTTAGCTCTTCCTCTGTAACGGCCAGATCAACTCTGACCTTCTCGGAGAAGAAAGGGAGTAGGTAGGAGAGAATGGAGGAGAGGAAAAGAAGAAGATAAGAGGGGA
ATCTTACATTAAATTTTTCATAGTACTGCAAATTGCAGCGCAGCAGCAGGTATAGCAATCTGCAGCTGCTTTCCGTTAGGGAAAATATCCAAAATGGTCCTCCAGCAAAGCGTAATAACA
ATAACTTAGAAAAATTGCAAAACAGTCTAAAACTCCTTAATTAATGCAAATTGATTCTGATCATGACATCCTCCTCGGTCAAACTGATTCATGTACCACTGAATCAGGCACCCATTTTCC
ATCACTTCTGCTCCCGGGGATGACTACCTTAGCGTACACATTCGGCAGTTAGGCGACTGGACACAAGAACTCAAAAGGGTATTCTCCGAGGCGTGCGAGCGCCCAGTTTCTGGGAAAAGC
GGCCTTCTCAGAGCTGATGAAACCACCAAGAAAAG
GTCAGCTGATGTGTATATTTATCTCCACATTCAATGTTTTCTATGTTTTGTTTTATGGTTCAAGTTTCTCAGTGAAGTGTGTAAC
ATATATATCTGGGTGATAACAGTTTGCCAAAGCTGTTAATAGATGGTCCTTATGGTGCCCCAGCGCAAGACTACCGGAAATATGATGTCTTGTTAGTTGTCGGTCTCGGAATCGGGGCAA
CGCCTTTCATCAGCATTCTCAAAGACTTGCAAAACAACATCGTGACGATGGAGGAGCAAGCG
GTTAGTAAATGATAAACCAAAAATAATAATGAAATAAGATAACAACTGAATCTCGTTT
AAATCATTTTTATTTGGTTTTCAGGATTCACTAACTGATGTCAACAGAGCATCAGAACAGAGCTTTGATGCCACGAGACGGAAAAAGGCTTTGAAGACCACGAATGCTTACTTCTACTGG
GTCACGAGGGAGCAAGGCTCGTTCGATTGGTTCAAAGGGGTGATGAACGAAATAGCGGATCATGATCAGAGG
GTAAATTTTGTGACCTTGTCTAACAGCATTGATTTTTTTTGGCTTTAA
GAGTGAGTTCGCTTGGATAACTTAAGATTATTGCTTGCACAGGGGGTCATTGAGATGCACAATTACTTAACCAGCGTATACGAGGAAGGCGATGCCAGATCAACCCTCATTACCATGGTC
CAAGCCTTAAACCATGCCAAGAACGGGGTGGACGTTGTCTCCGGCACCACT
GTAAGTCCAAAACTAATAAAATAGATCGATTTTACAAAACTTGTGGTGAAGTAGTAACTACTAAAAGAA
GTGTGCTGAGTGTTGATCACTTATTACAGGTACGAACCCATTTTGCGAGGCCGAACTGGAAAAAGGTTCTTTCCAAACTGAGTTCCAAGCACTGTAATGCAAGGATAGGTAAAAAGTTTG
ATGCTGATGTATCTCCAAATTAAGCTCCTTAAGCTAGATGAAACCTTTTTAACTAACCGCATGAGGTGTTGTGGGAAATAATAATGCAGGGGTGTTCTACTGTGGAGCTCCAGTTCTGGC
GAAAGAACTGGGGAAGCTGTGCTACGAATTTAATCAAAAGGGTTCTACCAAGTTTGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCACGAGAGGCGGTGGGGATCCGATTCTGTGCCGGCAAGGGGGGCGACGGCTAGCAGCAGCAGCGCAGGGACGTCTCGGGGGAGTTCGATGACAGGGGAGGAGTTCGTCGAGGTC
ACGCTTGATTTGCAGGACGATGACACGATTATCCTCAGGAGCGTTGAGCCGGCGACAGTCATTAACATCGCCGGCGGGAGTGATAGTGAAGGCGGAAGGGAGTTGGTTGCAGATAATTCA
ACTCCTGATTCGGCTCCGGCTTCCAGATCGCCGACGATCAAGCGGAGCTCGTCAAACAAGCTGCGGCAATTCTCGCACGAGCTGAAGGTGGAGGCGGTGGCGAAGGCAAGGCAGTTCTCT
CAGGAGCTAAAAGCGGAGCTCAGGAGGTTCTCCTGGAGCCAAGGACTGTCATCTCGCAATTCGCCAATGAACAATAATAATGGCGGTGCAGCTGCTGGATTCGATTCGGCGTTGGCTGCT
CGAGCTCTGAGGAGGCAGCGAGCTCAGCTCGATCGGACCAGGTCCGGAGCTCAGAAGGCGCTTCGCGGTCTCAAATTCATCAGTAACAGAAAATCGCAGGCCGCTGTGGATGCGTGGAAC
GAAGTCCATAGCAACTTCGAGAAGCTTGCAAAGGACGGTTATCTCTACCGCGCCGATTTCGCACAATGCATAG
GGATGAAGGACTCCAAGGAGTTTGCAGTGGAACTGTTCGACGCATTG
GGGAGGAGAAGAAGGCTGAAGGTGGAGAAGATTAGCAGGGACGAGCTTTACGAGTTCTGGTCACAAATCACCGATGACAGCTTCGATTCACGCCTCCAGATCTTCTTCGACAT
GGTAGAC
AAGAATGAAGATGGCAGAATTACAGAGGAAGAAGTAAAAGAG
ATTATTATGTTGAGTGCCTCCGCAAACAAATTATCCAGATTGAAGGAACAGGCAGAGGAATATGCAGCACTGATCATG
GAAGAGTTGGACCCCGAAAGACTTGGCTACATCGAG
TTATGGCAACTGGAAACGCTTCTTCTCCAGAAGGACACGTATCTAAACTACAGTCAAGCACTGAGCTACACGAGCCAAGCACTG
AGCCAGAACTTACAAGGGCTAAGAAGGCGAAGTCCAATCAAGCGGATGAGCACAAAGTTGGTCTACTTTCTGGAAGAGAACTGGAAAAGAATCTGGGTGGTGTCACTATGGATCATGATC
ATGGTCGGGCTATTCACATGGAAGTTTCATCAGTACAAGCAGAAAGCCGCTTTCAAGGTTATGGGTTACTGTCTCCTCACGGCAAAAGGCGCAGCGGAGACTTTGAAGTTCAACATGGCA
CTCATTCTCCTCCCAGTCTGTAGAAACACCATCACTCGCCTCAGGTCCACACGGCTGGCTTTTCTTGTGCCTTTCGACGACAACATCAACTTCCACAAG
ACTATTGCGACAGCAATCGTG
ATTGGTGTTATTCTGCACGTTGGAAATCACCTCGCCTGCGATTTTCCAAGGCTCGAGGGCTCGTCTCTGCAGGACTACAATCGGTACCTTAGAAATGACTTTGGACACCATAAACCCAGT
TACTGGAAACTGGTTAGAGGGCCAGAAGGTGTCACAGGGATTCTGATGGTGATTTGCATGATAATTGCGTTTACACTGGCAACCAGATGGTTCAGGCGTAGCCTTATTAAACTACCTAAA
CCATTTGACAGACTCACAGGATTCAATGCCTTTTGGTATTCACACCATCTATTCGTCAGCGTCTATATCTTGCTCGTCGTCCATGGAGAATACCTCTACTTGGTCCATCACTGGTATAAA
AAAACG
ACCTGGATGTACCTCTCTGTTCCTGTGTTTTTGTACGCTGGAGAAAGAGCTCTCAGGTTCTTCCGCTCTGGCTCCCATACAGTCCGGCTATTGAAGGTTGCAATTTATCCTGGA
AATGTGCTGACCTTAAAAATTTCCAAGCCTCCTCAGTTCCGGTACAAGAGTGGGCAGTACAT
GCACCCATTTTCCATCACTTCTGCTCCCGGGGATGACTACCTTAGCGTACACATTCGG
CAGTTAGGCGACTGGACACAAGAACTCAAAAGGGTATTCTCCGAGGCGTGCGAGCGCCCAGTTTCTGGGAAAAGCGGCCTTCTCAGAGCTGATGAAACCACCAAGAAAAG
TTTGCCAAAG
CTGTTAATAGATGGTCCTTATGGTGCCCCAGCGCAAGACTACCGGAAATATGATGTCTTGTTAGTTGTCGGTCTCGGAATCGGGGCAACGCCTTTCATCAGCATTCTCAAAGACTTGCAA
AACAACATCGTGACGATGGAGGAGCAAGCG
GATTCACTAACTGATGTCAACAGAGCATCAGAACAGAGCTTTGATGCCACGAGACGGAAAAAGGCTTTGAAGACCACGAATGCTTACTTC
TACTGGGTCACGAGGGAGCAAGGCTCGTTCGATTGGTTCAAAGGGGTGATGAACGAAATAGCGGATCATGATCAGAGG
GGGGTCATTGAGATGCACAATTACTTAACCAGCGTATACGAG
GAAGGCGATGCCAGATCAACCCTCATTACCATGGTCCAAGCCTTAAACCATGCCAAGAACGGGGTGGACGTTGTCTCCGGCACCACT
GTACGAACCCATTTTGCGAGGCCGAACTGGAAA
AAGGTTCTTTCCAAACTGAGTTCCAAGCACTGTAATGCAAGGATAG
GGGTGTTCTACTGTGGAGCTCCAGTTCTGGCGAAAGAACTGGGGAAGCTGTGCTACGAATTTAATCAAAAGGGT
TCTACCAAGTTTGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA