Entry information : LuRboh166(Lus10029896|PACid:23159670)
Entry ID 12202
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh166(Lus10029896|PACid:23159670)
Name LuRboh166(Lus10029896|PACid:23159670)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh166
start..stop
S start..stop
PtRboh10 1404 0 24..881 26..886
CsRboh03 1395 0 7..881 8..889
CclRboh03 1395 0 7..881 8..889
GmRboh02 1392 0 15..881 23..885
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 556733..557249 517 N° 2 556457..556616 160 N° 3 556213..556261 49 N° 4 555989..556102 114
N° 5 555474..555902 429 N° 6 554076..554465 390 N° 7 553882..553977 96 N° 8 553677..553792 116
N° 9 553488..553590 103 N° 10 552790..553351 562 N° 11 552590..552699 110  
complement(join(552590..552699,552790..553351,553488..553590,553677..553792,5538 82..553977,554076..554465,555474..555902,555989..556102,556213..556261,556457..5 56616,556733..557249))


exon

Literature and cross-references LuRboh166(Lus10029896|PACid:23159670)
DNA ref. Phytozome 11:   scaffold416 (557249..552590)
Protein sequence: LuRboh166(Lus10029896|PACid:23159670)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   882
PWM (Da):   %s   99502.09 Transmb domain:   %s   o340-359i419-441o479-501i522-544o554-571i700-717o
PI (pH):   %s   9.56
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEMHPADENRPDPGSRVPYSGPMSGPLSGPLVATTKKAKKSARFKDQQEEEYVEITLDIRDDAVSVQNIKGAGGGEMQETALLPGRRSGSLGSHLSFRVRQVSQELKRMASSSSKAAFEKVDRNKSGAARALKGLKFMSKNVGSGGWSDVEKRFDELAIDGALPKTRFAQCIGMKESGEFAGELFDALARRNGMTSAIISKADLHEFWEQINDKSFDARLQIFFDMVDKNADGRITKEEVKIIALSASANKLSKIQDRAEEYAALIMEELDPDNLGYIELYNLETLLLQAPSKSTNLGTESRALSQMLSQKLVRTKEFNPIRRWSHGVAYFVQDNWKRIWVMALWLAICAGLFTWKFVQYKRRAVFEVMGYCVSVAKGGAELTKFNMALILLPVCRNTITWLRSRTKLGKAVPFDDNINFHKVVAAGIAVGVGLHAISHLTCDFPRLLHATDEEYRPLAPFFGEERPNNYWWFVKGTEGWTGVLMVVLMAIAYVLAQPWFRRNRLRNLPKPLKKLTGFNAFWYSHHLFVIVYALFIVHGYYLYLSKDWYKKTTWMYVAVPMVLYVCERLVRAFRSGYKSVKILKVAVYPGNVLSLQMAKPPGFRYNSGQYLFVHCAAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTGQLKSVFAVCQPPSGNQSGLLRSDVSSSMPKLQIDGPYGAPAQDYKDYDVLLLVGLGIGATPLISIVKDVLNNIKQEKDRQLESGGGGGRPSFTTQRAYFYWVTREQGSFEWFRGVMNEVAEYDEDKVIELYNYCTSVYEEGDARSALITMLQSIQHAKSGVDIVSETRVKTHFARPDWRKVFKLIAVNHPNQRIGVFYCGAPGLTVELRKWAQEFSRKTSTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATGCACCCGGCAGACGAAAATCGGCCCGACCCTGGTTCTAGGGTCCCGTATAGTGGCCCGATGAGCGGGCCACTGAGCGGGCCGCTGGTGGCGACCACGAAGAAGGCGAAGAAG
AGTGCAAGGTTCAAGGACCAGCAAGAGGAGGAGTATGTTGAGATTACGCTTGATATTCGAGACGATGCAGTTTCGGTCCAGAACATTAAGGGCGCTGGTGGAGGCGAGATGCAGGAGACG
GCGTTGCTACCGGGCCGGCGGTCTGGATCGCTCGGGTCCCATCTCTCGTTCCGTGTCCGGCAAGTGTCACAGGAGCTGAAGCGGATGGCTTCGAGTTCGTCGAAGGCCGCGTTTGAGAAA
GTTGACCGGAACAAGTCCGGAGCCGCCAGGGCGTTGAAGGGGCTGAAGTTCATGTCCAAGAACGTCGGAAGTGGCGGCTGGTCGGACGTTGAGAAGCGGTTTGATGAGCTGGCGATTGAC
GGCGCGTTGCCCAAGACCAGATTCGCCCAATGCATTG
GTACGTTATACTTATTATTATTATATATGTTTAGTATTTAATTACTATGTAAGTTGACAATGGTCAAAATATTCGGCAAGGAC
TGAATCAAATGTTTTTTACTTTGTCGTGTTTAGGGATGAAGGAATCGGGAGAGTTCGCCGGCGAACTGTTCGATGCGCTGGCACGGCGGAATGGGATGACGTCGGCGATCATAAGCAAGG
CGGATTTGCATGAATTCTGGGAGCAAATAAATGACAAGAGCTTTGATGCTAGGCTACAGATTTTCTTTGACAT
GTACGTGATAATGGCCAAAGCAAAAAGTAACATATAATTGTATTAGA
TGGTGATTTGAATTTCGAACGGACAGGATGATAAAAGGATTCAACGTGGAAATTGGGTTAGAAGTTTCGAAAATTTTACTCAAAAAATCGGCCATAATGTTGATATTTTTAGAAATATAT
CAAAAATGATATTTTATTTTAATTACAGGGTGGACAAAAATGCGGATGGTCGAATAACGAAAGAGGAGGTTAAAGAGGTAACAAAAGTTAATGCTCAATGATTTACCTAACCCACTGATT
TTACCTTTTCAAGTTAATACAGTGAATGATGGCTAGTTAAGTATGATTAATATTTTGATAATTGCAGATTATTGCTCTTAGTGCTTCTGCTAATAAGTTATCCAAGATCCAAGACAGAGC
TGAAGAGTATGCAGCTTTGATCATGGAAGAACTGGACCCTGACAACTTGGGCTACATCGAG
GTCCATTTCCAGCCCATTATTATTTTGTTCAGCCCACTAAGCCCATTAGTCAATCTTCT
TACATATAATTTCTCTGCATGCTGCAGTTGTACAACTTGGAGACACTGCTCCTACAAGCACCAAGCAAATCAACCAACTTGGGAACGGAAAGCCGAGCCCTGAGCCAAATGCTGAGCCAG
AAGCTGGTTCGAACCAAAGAATTCAACCCGATCAGGCGGTGGTCGCACGGGGTGGCCTACTTCGTCCAGGACAACTGGAAGAGGATATGGGTCATGGCATTGTGGCTGGCCATATGCGCA
GGGCTGTTCACGTGGAAGTTCGTCCAGTACAAGCGACGCGCTGTATTCGAAGTCATGGGATACTGTGTCTCGGTGGCGAAAGGCGGGGCCGAGCTCACCAAGTTCAACATGGCTTTGATC
CTCCTGCCTGTTTGTAGGAACACTATAACGTGGCTTAGGAGTCGGACCAAGCTGGGGAAGGCCGTACCGTTTGATGACAACATCAATTTTCACAAG
GTAACTAAAATTGTGTTTACTCAT
TAACTTGCTTGTTTTAGGAGTGGAAATTCGGTCGGTCGTGATCAAACAAATAGATTTTGGATCGATAATCATGATAAAAATTGATGTAAATTCATCGTCGTGAATATGACCGAATTGATT
TTGACCAAACAAGACCGAATTGATTTTGACCTAACAAGGCCACGGTATACAAATTGCATTTTTATAGAAATTTTAATTAGGGGAGCATAGGGTCGGGTCAAGATCATAACTCACCCATAT
CCACCCGACATTGGATGGGTGTTGTAGATAGATGCAGATTGATTAGGTAATGATCCACTCAAAAGTGGGTGAGTTGATTTGGGTGGCGGCTAAACCACAAAACCCACCCATCACAACGAC
ATACTTCATGTTTATATGATAATGTCTATAATTTTTTCGCATTCTCTATCAAATTTTATGGCTTAGAATGTTTTAAAATTTTAAGGGCAGAATAGACTGCAAACCAAATTAGAAATATGA
TTGGACTGAACCACATTATATATGCTTGGTTACGGGTTTTGGCTCGAACACATGCAAACCAAATTATTCGATGATCATATTCGAGCCAAAATCTTTGACTGAACTCGAAACTGAACCCAC
GAATACAGTTATTTGAGGTCAATGCCCGTTTAAACCCGGTCGTAAATTGGGTTAGATAGAAAAAATCTCGACCAATTTCCCACCTCCCACTCAGGGTTGCCTCGGTTAACCCAAAAGTGG
GTCAATCCGAAAACCTTTTAGACACATTAATAACTATCCTAACGAACAACCAACTTTTTGAAACTGAACCCACGAATACAATTATTCTCGGTCAACACCCGTTTAATCTCGGTCGCAAAT
TCGGTTAAATAGAAATTAACCTCGACCAATTTCCCACCTCCCACTTACTGCCCGATTTGGTTAACCAAAATCGAAACGACTCCGAAAACCTTAAGACACATTATAACCACATCCTAACGA
ACTCTACCAACTTTTTTCTTACAGGTAGTAGCTGCCGGAATTGCAGTCGGAGTAGGCCTCCACGCGATCTCACATCTGACCTGCGACTTCCCACGGCTGCTCCACGCCACCGACGAGGAG
TACAGGCCGCTGGCCCCATTCTTCGGCGAGGAAAGGCCGAACAACTACTGGTGGTTCGTGAAAGGAACCGAAGGCTGGACGGGGGTCCTGATGGTGGTGCTCATGGCTATAGCCTACGTT
CTGGCTCAGCCGTGGTTTCGCCGTAACCGTCTCAGGAACCTTCCGAAACCGTTAAAGAAGTTGACCGGGTTCAACGCGTTCTGGTACTCGCACCACTTGTTCGTCATCGTCTATGCTCTG
TTTATCGTTCATGGGTACTACTTGTACCTCTCCAAGGACTGGTACAAGAAAACG
GTAAGCCGAATTACCATTTTGTCCACATTTACAGATTCTATATTCGATAAGGAGTTAATAAATCTG
ACAGAGTATTTTGGATATTTGTTATTTTGCAGACGTGGATGTACGTTGCGGTTCCGATGGTGTTGTATGTTTGTGAACGACTCGTTCGTGCTTTCAGATCGGGTTATAAATCAGTCAAGA
TTCTCAAG
GTAAAATATATATAACAATTGATTAAATGTGTATTAAACATTTGAATTACTTAATTACCCTTAATCATTCGTAATTAAACATTGTTCAGGTGGCAGTGTACCCTGGAAATGT
ACTGTCTCTACAAATGGCGAAGCCTCCAGGATTCCGATACAATAGCGGTCAATACCTGTTTGTGCATTGTGCAGCGGTTTCACCGTTCGAGTG
GTGAGTTTTCGAGCCATAACTCGACCG
ATTCTTTTATATTTTTACCGCTGATTTCGCTGATTCGTGCTCGGTTGGTCCGTTTTCAGGCATCCATTCTCGATCACTTCCGCTCCAGGAGACGACTACCTCAGTGTCCACATCCGTACC
TTGGGAGATTGGACCGGACAGCTCAAATCCGTATTTGCTAAG
GTAATCAAATTCTATTTGGCTTGGTATGATTTCAAGTTAATCAAATTGAAACACTTTTGATTTCGGTTGAACCGGAAA
CTCAAAACAAAAAAATCCTCTGTTTCAGTTCCCCTGAATTCCTTTTTTCTTCTTTCAGGTATGTCAACCACCATCAGGAAACCAAAGCGGCCTCCTGAGATCCGACGTCTCAAGCTCTAT
GCCTAAGCTTCAAATCGACGGACCATATGGAGCTCCGGCACAGGACTACAAGGACTACGACGTCCTTCTCCTAGTCGGATTAGGAATCGGAGCCACTCCTCTTATCAGCATCGTCAAGGA
CGTCCTTAACAACATCAAGCAGGAGAAGGACCGCCAGCTGGAATCCGGCGGCGGGGGTGGAAGGCCGTCGTTCACGACGCAGAGAGCTTACTTCTACTGGGTGACGAGGGAGCAAGGATC
GTTCGAGTGGTTCCGAGGGGTGATGAACGAGGTGGCGGAGTATGACGAGGACAAGGTGATCGAGCTTTACAACTACTGTACGAGTGTCTACGAGGAAGGCGACGCCCGATCGGCGTTGAT
CACGATGCTCCAGTCGATCCAGCACGCCAAGAGCGGGGTCGATATCGTGTCGGAGACGAGGGTAAAGACCCATTTTGCTAGGCCCGACTGGAGGAAGGTCTTCAAGCTTATCGCTGTTAA
CCACCCGAACCAAAGAATTG
GTACGTACAATAATATTTTCTCTTTGCTAAGGGTTGGAAATGGTAGGGGTATAAACGTCAACTTATGTTGTTTGTGTATTTTTTTTCCAGGTGTGTTTTA
TTGTGGGGCTCCAGGATTGACTGTAGAATTGAGGAAATGGGCTCAAGAATTTTCAAGGAAGACTTCTACCAAGTTTGATTTCCATAAGGAGAATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATGCACCCGGCAGACGAAAATCGGCCCGACCCTGGTTCTAGGGTCCCGTATAGTGGCCCGATGAGCGGGCCACTGAGCGGGCCGCTGGTGGCGACCACGAAGAAGGCGAAGAAG
AGTGCAAGGTTCAAGGACCAGCAAGAGGAGGAGTATGTTGAGATTACGCTTGATATTCGAGACGATGCAGTTTCGGTCCAGAACATTAAGGGCGCTGGTGGAGGCGAGATGCAGGAGACG
GCGTTGCTACCGGGCCGGCGGTCTGGATCGCTCGGGTCCCATCTCTCGTTCCGTGTCCGGCAAGTGTCACAGGAGCTGAAGCGGATGGCTTCGAGTTCGTCGAAGGCCGCGTTTGAGAAA
GTTGACCGGAACAAGTCCGGAGCCGCCAGGGCGTTGAAGGGGCTGAAGTTCATGTCCAAGAACGTCGGAAGTGGCGGCTGGTCGGACGTTGAGAAGCGGTTTGATGAGCTGGCGATTGAC
GGCGCGTTGCCCAAGACCAGATTCGCCCAATGCATTG
GGATGAAGGAATCGGGAGAGTTCGCCGGCGAACTGTTCGATGCGCTGGCACGGCGGAATGGGATGACGTCGGCGATCATAAGC
AAGGCGGATTTGCATGAATTCTGGGAGCAAATAAATGACAAGAGCTTTGATGCTAGGCTACAGATTTTCTTTGACAT
GGTGGACAAAAATGCGGATGGTCGAATAACGAAAGAGGAGGTT
AAAGAG
ATTATTGCTCTTAGTGCTTCTGCTAATAAGTTATCCAAGATCCAAGACAGAGCTGAAGAGTATGCAGCTTTGATCATGGAAGAACTGGACCCTGACAACTTGGGCTACATCGAG
TTGTACAACTTGGAGACACTGCTCCTACAAGCACCAAGCAAATCAACCAACTTGGGAACGGAAAGCCGAGCCCTGAGCCAAATGCTGAGCCAGAAGCTGGTTCGAACCAAAGAATTCAAC
CCGATCAGGCGGTGGTCGCACGGGGTGGCCTACTTCGTCCAGGACAACTGGAAGAGGATATGGGTCATGGCATTGTGGCTGGCCATATGCGCAGGGCTGTTCACGTGGAAGTTCGTCCAG
TACAAGCGACGCGCTGTATTCGAAGTCATGGGATACTGTGTCTCGGTGGCGAAAGGCGGGGCCGAGCTCACCAAGTTCAACATGGCTTTGATCCTCCTGCCTGTTTGTAGGAACACTATA
ACGTGGCTTAGGAGTCGGACCAAGCTGGGGAAGGCCGTACCGTTTGATGACAACATCAATTTTCACAAG
GTAGTAGCTGCCGGAATTGCAGTCGGAGTAGGCCTCCACGCGATCTCACAT
CTGACCTGCGACTTCCCACGGCTGCTCCACGCCACCGACGAGGAGTACAGGCCGCTGGCCCCATTCTTCGGCGAGGAAAGGCCGAACAACTACTGGTGGTTCGTGAAAGGAACCGAAGGC
TGGACGGGGGTCCTGATGGTGGTGCTCATGGCTATAGCCTACGTTCTGGCTCAGCCGTGGTTTCGCCGTAACCGTCTCAGGAACCTTCCGAAACCGTTAAAGAAGTTGACCGGGTTCAAC
GCGTTCTGGTACTCGCACCACTTGTTCGTCATCGTCTATGCTCTGTTTATCGTTCATGGGTACTACTTGTACCTCTCCAAGGACTGGTACAAGAAAACG
ACGTGGATGTACGTTGCGGTT
CCGATGGTGTTGTATGTTTGTGAACGACTCGTTCGTGCTTTCAGATCGGGTTATAAATCAGTCAAGATTCTCAAG
GTGGCAGTGTACCCTGGAAATGTACTGTCTCTACAAATGGCGAAG
CCTCCAGGATTCCGATACAATAGCGGTCAATACCTGTTTGTGCATTGTGCAGCGGTTTCACCGTTCGAGTG
GCATCCATTCTCGATCACTTCCGCTCCAGGAGACGACTACCTCAGTGTC
CACATCCGTACCTTGGGAGATTGGACCGGACAGCTCAAATCCGTATTTGCTAAG
GTATGTCAACCACCATCAGGAAACCAAAGCGGCCTCCTGAGATCCGACGTCTCAAGCTCTATGCCT
AAGCTTCAAATCGACGGACCATATGGAGCTCCGGCACAGGACTACAAGGACTACGACGTCCTTCTCCTAGTCGGATTAGGAATCGGAGCCACTCCTCTTATCAGCATCGTCAAGGACGTC
CTTAACAACATCAAGCAGGAGAAGGACCGCCAGCTGGAATCCGGCGGCGGGGGTGGAAGGCCGTCGTTCACGACGCAGAGAGCTTACTTCTACTGGGTGACGAGGGAGCAAGGATCGTTC
GAGTGGTTCCGAGGGGTGATGAACGAGGTGGCGGAGTATGACGAGGACAAGGTGATCGAGCTTTACAACTACTGTACGAGTGTCTACGAGGAAGGCGACGCCCGATCGGCGTTGATCACG
ATGCTCCAGTCGATCCAGCACGCCAAGAGCGGGGTCGATATCGTGTCGGAGACGAGGGTAAAGACCCATTTTGCTAGGCCCGACTGGAGGAAGGTCTTCAAGCTTATCGCTGTTAACCAC
CCGAACCAAAGAATTG
GTGTGTTTTATTGTGGGGCTCCAGGATTGACTGTAGAATTGAGGAAATGGGCTCAAGAATTTTCAAGGAAGACTTCTACCAAGTTTGATTTCCATAAGGAGAAT
TTTTAA

Retrieve as FASTA