Entry information : LuRboh178(Lus10032308|PACid:23168672)
Entry ID 12203
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh178(Lus10032308|PACid:23168672)
Name LuRboh178(Lus10032308|PACid:23168672)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh178
start..stop
S start..stop
LuRboh159 1546 0 1..963 1..931
PtRboh02 1538 0 2..963 7..949
PtRboh03 1530 0 2..963 7..948
CsRboh01 1521 0 3..963 7..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 668670..669384 715 N° 2 669486..669645 160 N° 3 669872..669920 49 N° 4 670560..670673 114
N° 5 671516..671938 423 N° 6 672266..672652 387 N° 7 672741..672836 96 N° 8 672928..673043 116
N° 9 673144..673311 168 N° 10 673414..673573 160 N° 11 673677..673862 186 N° 12 673959..674166 208
N° 13 674272..674381 110  
join(668670..669384,669486..669645,669872..669920,670560..670673,671516..671938, 672266..672652,672741..672836,672928..673043,673144..673311,673414..673573,67367 7..673862,673959..674166,674272..674381)


exon

Literature and cross-references LuRboh178(Lus10032308|PACid:23168672)
DNA ref. Phytozome 11:   scaffold291 (668670..674381)
Protein sequence: LuRboh178(Lus10032308|PACid:23168672)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   964
PWM (Da):   %s   109673.45 Transmb domain:   %s   o405-424i544-566o586-608i765-782o
PI (pH):   %s   9.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKHERRWRSDSLPGKGRAADSSSSSSAETSPVSDSRSSTAEAKEDFVEVTLDLQDDDTIILRSVEPATVINIGGEEGDHESGGSELLPRSTPTSAPTSRSPTIKRSSSNKLRQFSQELKADAVAKARQFSLDVRAELRRFSKSRGGTTSRNNNNPENNNNGGGGVSFSLVFFSLLSLRGRVPPRRARTRTSAHKALRGLKFISKRKSQGVEAWNEVASNFDKLAVDGYIQRADFAQCIGMRDSKEFALELFDGLSRRRRLKVEKLSKEELYEFWAQITDDSFDSRLQIFFDMVDKNEDGRLTEEDVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYQNYSQAMSYTSQALSQNLQGLRMRSPIRRMSTNLVYFLEMNWKRIWVISLWIMIMIGLFAWKFYQYKQKAAFNVMGYCLLTAKGAAETLKFNMALILLPVCRNTITRLRSTRLAYVFPFDDNINFHKTIAAAIVVGVILHVGNHLACDFPRLESASARDYDLYLRKDFGDHKPSYMKLVRGVEGVTGILMVIFMAIAFTLATRWFRRNLIKFPKPFDRITGFNAFWYSHHLFVLVYILLVVHGIFLYLVHHWYKKTTWMYLSVPVLLYAGERALRFFRSGSHSVRLLKVAIYPGNVLTLQMSKPSQFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSVHIRQLGDWTQELKRVFSEVCERPISGKSGLLRADETTKRSLPKLLIDGPYGAPAQDYKKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEMDSVADSSRGSDQLSFTSTTDFMRRRKALIKTTNAYFYWVTREQGSFDWFKGVMNEIADLDQRGVLEMHNYLTSVYEEGDARSTLITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLSKLSSKHCNARIGVFYCGAPVLANELGKLCYEFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCACGAGAGGCGATGGCGATCGGATTCATTACCTGGAAAGGGCAGAGCAGCTGACAGTAGTAGCAGCAGTAGTGCGGAGACATCTCCGGTGAGCGATTCGAGAAGCTCGACAGCG
GAAGCGAAGGAGGATTTCGTCGAGGTCACGCTCGATTTGCAGGACGACGATACGATTATACTCCGAAGCGTTGAGCCGGCGACGGTGATCAATATCGGCGGAGAGGAAGGCGATCACGAG
AGCGGCGGAAGCGAGCTGTTACCTCGTTCGACTCCTACTTCCGCTCCGACTTCCAGATCTCCTACGATCAAGCGAAGCTCATCGAACAAACTGCGGCAGTTCTCGCAGGAGCTGAAGGCG
GACGCGGTGGCGAAGGCGAGGCAATTCTCGCTGGATGTGAGAGCTGAGCTCCGTAGGTTCTCGAAGAGCCGTGGAGGAACAACGTCGCGTAATAATAATAATCCGGAGAACAACAACAAT
GGCGGGGGCGGTGTTTCTTTCTCGCTGGTTTTTTTTTCTTTGCTCTCGCTGCGGGGCCGTGTACCGCCTCGCCGCGCCCGGACCAGGACCAGCGCTCACAAAGCCCTGCGGGGTCTCAAG
TTCATCAGTAAGAGGAAATCTCAAGGCGTCGAGGCGTGGAACGAAGTGGCCAGCAACTTCGATAAGCTCGCCGTGGACGGTTATATCCAACGCGCGGATTTCGCGCAATGCATAG
GTTAG
TTTTTAAATCCCTAATCAAGGCGGCATGTCAGTGTTTCCATTCGATTTGGATCATTTCGGCTGGTGTAATTGATTTTGTCAAGTTCTGGATTGAAGGGATGAGAGACTCTAAAGAGTTTG
CGCTCGAACTGTTCGACGGATTGAGCAGGAGAAGGAGGTTGAAGGTGGAGAAGCTTAGCAAGGAGGAGCTGTACGAATTCTGGGCACAAATCACCGATGACAGCTTCGACTCACGGCTCC
AGATCTTCTTCGACAT
GTACGCATAAAAGCACAAAACAATGATGATCGATCAATTTAGAAACTCTTAATCACCTCCTTAATTAACTAATTAATTAGTCAATACTAATTTGGTATTAGGTA
TTAATTAATTAGTCAATACTAATTTGACAAGACAAAATCGTCCTTTCTGACGTGTCCATTTCTTATTGCTTTACGTTTCGGATGCTTGTGAGCTTTCTTAATAGTAAAGCTTATTGTAAC
AGGGTGGACAAGAATGAAGATGGTAGACTCACAGAGGAAGACGTAAAAGAGGTACCTGCAGTTTCCAGTTTATCTTATCAATCCTTGTTTAATCATTGAAGGAATCAGTCTACATTATTG
TTATTATATCCATGGCTAATTTTAAAGGTCTAAGCCTAGAGTCATGAATTAGTCAATCAGGCACCACTACCCTGTCAATTACTTGAGGAAGAAACTAACTAATCAGTATTTTAACCAGCC
ATTTTAGCAGCCGTCAATCCCCACAGAAGTGTCATATGACTTTTTTGCATCAAATTATATTCCCAGGACTAACTGCTCCAGTACTGCAATGAAACCATATTGTATTGTTTCCACGATTCG
TTTGTTTATCAAACGATTCCATTATATTTGGTGACGTTCCCTATATTCTGGCTTCTGACATATTATCTTTGGATTGTTGGACTGGATCTACTCCTCTTAGTAAAAGGGGTTTGGAATTGG
GTTGACAACATTTGGCATTTTTTTTTATGTTCCGACTTCCGACTTCCGAACGTAGCGTCAGGAAGTTTACATGTCATTTTGTTGTTTGGGGTAGGTAGGAGGCTTTGTTCCCTCGGCCAG
AGAGACTTGCTATAGGGGCTTTATTCTTTCTTGCGTTTTTACCTTTTTACTTACTAATTACTGACTTTCTATTCTCTGTATTTTTTATAGATTATTATGTTAAGTGCTTCGGCCAATAAA
TTATCAAGATTAAAGGAACAAGCAGAAGAATATGCAGCTTTGATCATGGAAGAGTTGGACCCTGAAGGACTTGGCTACATCGAG
GTGGGTCCTAGTCCTACATTTATGTGTTCACTTACG
TTGATTCTTGTGCTAGAAGCAATAGCGTTAAACTGCATTAACATATATTTATAAGTCTTAACAATAATATTATTTAAGTAAGGAGTCATTTTCAGTCTAGTTTTCATATACTAGTTAACT
GCTCTTTGCGGGGAGGTTGTTTGGCTAAATACATGTTTAATGAAAGCCAAGTCTGACCATTCTTCTAGATTCTTAATCAATTACCAAACAAGAATCGGTTACAACATTTCTATCATGATG
CTTTTCTTTCAAAGTCCATTAATTGTTAGGCCAAAAAAAAAATGACAAGTCATCGAGAATTGGGGTTGTGATGTTGTTCAACTGTGTACGAAGAAAAAAAGATGACGAAGCAAGTGGAGA
AGGATCATTAATTTGGTTAAGTAAGCTTATCTAAGTGGATTTCTCGTTTTGGGTGGTTGAACAGCTTTCCTAGTTGTTGCTTATTTTTCCATCTTTCCGCCTTCCCATAACCTGCTCTAC
TATTTTTACTAGTTGATTGTCATGTTATTGTGGCATGATAAGCTAGTGAAACAGTATAGAAAATATTGGCATGAGCTAGTGACACAAAATGGTCTGTCAAAATTGTCAATAGGGTTTGGA
GGGAAATCTAGCTCTAGAGAGTAAATGCCATTTGACTGTTGAGAAATTCTTGGGGCTCATAAAACATAATTGAACAAAAATACTGATCACATCCTAGCTTCAGTACTTTTGGAGAGGAAC
TGCACTTCAGTACTTTTACTGGCCTAGTTGGAGTGACTGAGAGATAGATACCATACCACAGTCCTAAGTTGATAATGATACTGCAGCTATGGCAACTGGAGACGCTTCTTCTACAAAAGG
ACACATATCAAAACTACAGTCAAGCAATGAGCTACACGAGCCAAGCCTTGAGCCAGAACTTGCAAGGGCTAAGAATGAGAAGCCCAATAAGGAGGATGAGCACAAACTTAGTCTACTTCT
TGGAAATGAACTGGAAGAGGATCTGGGTGATATCCTTATGGATCATGATCATGATTGGACTGTTCGCATGGAAATTCTATCAGTACAAGCAGAAAGCTGCCTTCAATGTCATGGGTTACT
GTCTCCTGACGGCAAAGGGTGCTGCGGAGACTCTGAAGTTCAATATGGCCCTTATTCTGCTTCCCGTGTGTAGAAACACCATCACTCGGCTCAGGTCCACACGGCTGGCTTATGTTTTCC
CTTTCGATGACAACATAAACTTCCACAAG
GTACATTTTCCTAGTTTCACACACCAACCCCCTTTTCGTTTCTGTTTCTCTTGCGTAAACTGCTTTGCGTTTTTTGGACGTTAATCAAGTG
GGGTCATATCATGGAGACTGTATCAGACAGTACTATGATGGTTGATCTTGTATCCGTGTAGTTCGATAATGTTACTGTTCCAAAAGTTAATGATCACTTTATTCCAAGGAAGAAAGACAA
AAAGGAAAAGCTTGCTTAGTTAATTTTATGACTTCGTAGACTAAACAGATAGAACTTTCAGCATTGACACAGGCATTGATAAAACTGTGCTTGGCGTTCTTCCTTTATGTCTACAGACTA
TTGCGGCAGCAATCGTAGTTGGCGTCATCCTTCACGTTGGAAACCACCTTGCCTGTGATTTCCCGAGGCTTGAAAGCGCTTCTGCACGTGACTACGATCTGTACCTCAGAAAAGACTTCG
GAGACCATAAACCAAGTTACATGAAATTAGTTAGGGGGGTAGAGGGCGTGACTGGAATCCTGATGGTAATTTTCATGGCAATTGCATTCACCCTGGCAACGAGATGGTTCAGGCGTAACC
TCATTAAATTTCCCAAACCGTTTGACAGAATCACTGGGTTCAATGCCTTCTGGTATTCACACCACTTATTTGTCCTCGTCTATATATTGCTGGTCGTCCATGGTATATTCCTCTACCTGG
TTCATCACTGGTATAAGAAAACG
GTAAGGTTACCAATATTGCTTCCTTCCCTTTCAATAGATTCATCGTTCCATTTAGAATGTTGGTTCGACGTTTTTACATGCCTGACAGACGTGGATG
TACCTCTCTGTCCCTGTGCTGCTTTACGCCGGAGAAAGAGCCCTCAGATTCTTCCGCTCTGGCTCCCATTCAGTCCGGCTTTTGAAG
GTTGGTTAGCAGCCTATTAATACTGTTATATGA
TTGCCCAAAGGATCTGTTTTTATAAGCTATTTACCAATATTGATATATGCGTTTACAGGTTGCAATTTACCCTGGCAACGTACTCACATTGCAAATGTCAAAGCCTAGTCAATTCCGTTA
CAAGAGCGGGCAGTACATGTTTGTTCAGTGCCCTGCTGTTTCTCCATTTGAATG
GTAAAATACTCTGCTTTTTCCTCTGTTGCCTTTTTTCTCTTCTCGTGTTCTGTCATAATCTTAAGA
CTTGTATCTGATTCAATTTACCTATTCTCTCCAGGCACCCATTCTCGATAACTTCAGCTCCTGGAGATGACTACCTTAGCGTCCACATACGACAGTTAGGTGACTGGACTCAAGAACTCA
AAAGGGTATTCTCTGAGGTCTGCGAGCGTCCTATTTCTGGCAAAAGTGGCCTTCTTAGAGCTGATGAAACCACCAAGAGAAG
GTGATTATAGCTGAATCTTGTCAACATTTCCTTTCTTT
TTATTTTCTCTGCCCAATATCTGAATGGTGAAACTGAAACATTTCTATCTCCGATTATATACAGTTTGCCGAAGCTGTTAATAGATGGGCCATACGGCGCTCCAGCGCAAGACTACAAGA
AATACGACGTCTTGTTACTGGTGGGGTTGGGTATCGGAGCAACGCCTTTCATCAGCATTCTCAAAGACTTGCTTAATAACATTGTTAAGATGGAGGAGATGGCT
GTAAGTAAACTACACA
AGAAATGGAAAAAAGAAAAAAGTGGACTGAATCTGTTTCCATTCCAACTAACATACATAGCCACATTAATTCTTCATGTTTGTGCAGGATTCCGTAGCGGACTCCAGTAGAGGATCGGAT
CAGCTGAGCTTTACGAGCACCACCGACTTTATGAGACGGAGGAAGGCGTTGATAAAAACCACAAACGCTTACTTTTACTGGGTAACGAGGGAACAAGGCTCGTTCGATTGGTTCAAAGGC
GTGATGAACGAGATTGCCGACCTTGATCAGAGG
GTACGTAAGAACTATTAGTTACATTAAAACTCCAACACAGAAAAATGCTGCTACCTTGTCATTTGATTTGACTTACCTGAGTGTTAA
TCAATCCAGGGAGTACTTGAGATGCACAACTACTTAACCAGTGTATACGAGGAAGGGGACGCGAGATCGACTCTGATCACGATGGTGCAAGCATTGAACCACGCCAAGAACGGAGTGGAC
ATTGTCTCGGGCACCAGGGTGCGGACTCATTTTGCGAGGCCTAACTGGAAGAAGGTGCTCTCGAAATTAAGCTCAAAGCACTGTAATGCAAGGATAG
GTAATTAAAGGCAGTTCACTAGC
TATATACTTTCCCAGGTAGTCATGTTCGATCTGAGAAGGGTTTTGATTATATTAATGCTGATGTATGTGGTGGGGAATGCAGGGGTATTCTACTGTGGGGCACCAGTTCTGGCAAACGAA
CTTGGAAAGCTATGCTACGAGTTCAACCAGAAGGGTTCTACCAAGTTCGAATTCCACAAGGAGCATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCACGAGAGGCGATGGCGATCGGATTCATTACCTGGAAAGGGCAGAGCAGCTGACAGTAGTAGCAGCAGTAGTGCGGAGACATCTCCGGTGAGCGATTCGAGAAGCTCGACAGCG
GAAGCGAAGGAGGATTTCGTCGAGGTCACGCTCGATTTGCAGGACGACGATACGATTATACTCCGAAGCGTTGAGCCGGCGACGGTGATCAATATCGGCGGAGAGGAAGGCGATCACGAG
AGCGGCGGAAGCGAGCTGTTACCTCGTTCGACTCCTACTTCCGCTCCGACTTCCAGATCTCCTACGATCAAGCGAAGCTCATCGAACAAACTGCGGCAGTTCTCGCAGGAGCTGAAGGCG
GACGCGGTGGCGAAGGCGAGGCAATTCTCGCTGGATGTGAGAGCTGAGCTCCGTAGGTTCTCGAAGAGCCGTGGAGGAACAACGTCGCGTAATAATAATAATCCGGAGAACAACAACAAT
GGCGGGGGCGGTGTTTCTTTCTCGCTGGTTTTTTTTTCTTTGCTCTCGCTGCGGGGCCGTGTACCGCCTCGCCGCGCCCGGACCAGGACCAGCGCTCACAAAGCCCTGCGGGGTCTCAAG
TTCATCAGTAAGAGGAAATCTCAAGGCGTCGAGGCGTGGAACGAAGTGGCCAGCAACTTCGATAAGCTCGCCGTGGACGGTTATATCCAACGCGCGGATTTCGCGCAATGCATAG
GGATG
AGAGACTCTAAAGAGTTTGCGCTCGAACTGTTCGACGGATTGAGCAGGAGAAGGAGGTTGAAGGTGGAGAAGCTTAGCAAGGAGGAGCTGTACGAATTCTGGGCACAAATCACCGATGAC
AGCTTCGACTCACGGCTCCAGATCTTCTTCGACAT
GGTGGACAAGAATGAAGATGGTAGACTCACAGAGGAAGACGTAAAAGAGATTATTATGTTAAGTGCTTCGGCCAATAAATTATCA
AGATTAAAGGAACAAGCAGAAGAATATGCAGCTTTGATCATGGAAGAGTTGGACCCTGAAGGACTTGGCTACATCGAG
CTATGGCAACTGGAGACGCTTCTTCTACAAAAGGACACATAT
CAAAACTACAGTCAAGCAATGAGCTACACGAGCCAAGCCTTGAGCCAGAACTTGCAAGGGCTAAGAATGAGAAGCCCAATAAGGAGGATGAGCACAAACTTAGTCTACTTCTTGGAAATG
AACTGGAAGAGGATCTGGGTGATATCCTTATGGATCATGATCATGATTGGACTGTTCGCATGGAAATTCTATCAGTACAAGCAGAAAGCTGCCTTCAATGTCATGGGTTACTGTCTCCTG
ACGGCAAAGGGTGCTGCGGAGACTCTGAAGTTCAATATGGCCCTTATTCTGCTTCCCGTGTGTAGAAACACCATCACTCGGCTCAGGTCCACACGGCTGGCTTATGTTTTCCCTTTCGAT
GACAACATAAACTTCCACAAG
ACTATTGCGGCAGCAATCGTAGTTGGCGTCATCCTTCACGTTGGAAACCACCTTGCCTGTGATTTCCCGAGGCTTGAAAGCGCTTCTGCACGTGACTAC
GATCTGTACCTCAGAAAAGACTTCGGAGACCATAAACCAAGTTACATGAAATTAGTTAGGGGGGTAGAGGGCGTGACTGGAATCCTGATGGTAATTTTCATGGCAATTGCATTCACCCTG
GCAACGAGATGGTTCAGGCGTAACCTCATTAAATTTCCCAAACCGTTTGACAGAATCACTGGGTTCAATGCCTTCTGGTATTCACACCACTTATTTGTCCTCGTCTATATATTGCTGGTC
GTCCATGGTATATTCCTCTACCTGGTTCATCACTGGTATAAGAAAACG
ACGTGGATGTACCTCTCTGTCCCTGTGCTGCTTTACGCCGGAGAAAGAGCCCTCAGATTCTTCCGCTCTGGC
TCCCATTCAGTCCGGCTTTTGAAG
GTTGCAATTTACCCTGGCAACGTACTCACATTGCAAATGTCAAAGCCTAGTCAATTCCGTTACAAGAGCGGGCAGTACATGTTTGTTCAGTGCCCT
GCTGTTTCTCCATTTGAATG
GCACCCATTCTCGATAACTTCAGCTCCTGGAGATGACTACCTTAGCGTCCACATACGACAGTTAGGTGACTGGACTCAAGAACTCAAAAGGGTATTCTCT
GAGGTCTGCGAGCGTCCTATTTCTGGCAAAAGTGGCCTTCTTAGAGCTGATGAAACCACCAAGAGAAG
TTTGCCGAAGCTGTTAATAGATGGGCCATACGGCGCTCCAGCGCAAGACTAC
AAGAAATACGACGTCTTGTTACTGGTGGGGTTGGGTATCGGAGCAACGCCTTTCATCAGCATTCTCAAAGACTTGCTTAATAACATTGTTAAGATGGAGGAGATGGCT
GATTCCGTAGCG
GACTCCAGTAGAGGATCGGATCAGCTGAGCTTTACGAGCACCACCGACTTTATGAGACGGAGGAAGGCGTTGATAAAAACCACAAACGCTTACTTTTACTGGGTAACGAGGGAACAAGGC
TCGTTCGATTGGTTCAAAGGCGTGATGAACGAGATTGCCGACCTTGATCAGAGG
GGAGTACTTGAGATGCACAACTACTTAACCAGTGTATACGAGGAAGGGGACGCGAGATCGACTCTG
ATCACGATGGTGCAAGCATTGAACCACGCCAAGAACGGAGTGGACATTGTCTCGGGCACCAGGGTGCGGACTCATTTTGCGAGGCCTAACTGGAAGAAGGTGCTCTCGAAATTAAGCTCA
AAGCACTGTAATGCAAGGATAG
GGGTATTCTACTGTGGGGCACCAGTTCTGGCAAACGAACTTGGAAAGCTATGCTACGAGTTCAACCAGAAGGGTTCTACCAAGTTCGAATTCCACAAG
GAGCATTTCTAG

Retrieve as FASTA