Entry information : LuRboh184(Lus10033423|PACid:23172085)
Entry ID 12204
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh184(Lus10033423|PACid:23172085)
Name LuRboh184(Lus10033423|PACid:23172085)
Class Respiratory burst oxidase homolog    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh184
start..stop
S start..stop
LuRboh189 1650 0 14..847 114..955
PtRboh09 1355 0 14..847 102..926
VvRboh07 1314 0 14..847 92..917
CclRboh04 1295 0 21..847 94..910
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1282408..1282762 355 N° 2 1282848..1283007 160 N° 3 1283475..1283523 49 N° 4 1283618..1283731 114
N° 5 1284484..1285293 810 N° 6 1285385..1285480 96 N° 7 1285568..1285683 116 N° 8 1285770..1285940 171
N° 9 1286037..1286196 160 N° 10 1286295..1286489 195 N° 11 1286591..1286719 129 N° 12 1286793..1286871 79
N° 13 1286949..1287058 110  
join(1282408..1282762,1282848..1283007,1283475..1283523,1283618..1283731,1284484 ..1285293,1285385..1285480,1285568..1285683,1285770..1285940,1286037..1286196,12 86295..1286489,1286591..1286719,1286793..1286871,1286949..1287058)


exon

Literature and cross-references LuRboh184(Lus10033423|PACid:23172085)
DNA ref. Phytozome 11:   scaffold488 (1282408..1287058)
Protein sequence: LuRboh184(Lus10033423|PACid:23172085)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   847
PWM (Da):   %s   96191.21 Transmb domain:   %s   o288-307i418-440o466-488i646-663o
PI (pH):   %s   9.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEELICKHQAKEDLSATSRIRKKFGWLRSGSSRTTASEIDGGAITERDARRIRANLQRSKSSAERALKGLKFISKASSSTVAGGGGDAEQLWRRVESRFDSLSSRDGFLARDDFGECIGMVDSKEFAGSVFDALARRKGQRISRITKEELREFWLQITDHSFDARLQIFFDMADSNDDGRITREEVQLITLSASANKLSKLKEQAEEYAGLIMEELDPENLGYIELWQLETLLLRRDAYMNYSRPLSTASLGWSQNLSTRFQPRIMGRRLTSMLRSIIVENWQRGCILTLWLILMTLLFAWKFVNYRNRAAFQVMGYCLTTAKGAAETLKLNMALILLPVCRNTITWLRSTKARTVIPFDDNINFHKMIAVSIVIGVVLHAGNHLVCDFPRLTNASPEKFSLIASQFDGKKPTYRDLISSVEGVTGISMVVLMAIAFTLATSQFRRNLVKLPAPFNRLTGFNAFWYSHHLTGIVYILLFVHGTFLYLTDTWYDKNTWMYLSVPLLLYVVERTIRTCRSEHQSAKIIRVTVLPGDVFSLTMSKPQGFKYKSGQYIFLQCPSISSFEWHPFSITSAPGDEYLSVHVRIVGDWTQELKRVFTEVNDSPTVIGRAKFGQLGHMDHRGQPKLYVDGPYGAPAQDYKNYDVLLLVGLGIGATPFISILRDLLNNTRTTDYQDSNTDTSRSDYSSNSCTSSNGTGGNTIKKKTVRTTNAHFYWVTREPGSFEWFKGVMDEVAEMDHKGQIEMHNYLTSVYEEGDARSTLITMVQALNHAKHGVDIVSGTRVRTHFARPNWREVFTKIASKHPFATIGVFYCGMPTLAKELKKLSQEMSHRTSTRFEFHKEYF

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. 5' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGAGCTTATCTGCAAGCACCAGGCAAAGGAAGACTTATCTGCCACATCCAGGATAAGGAAGAAGTTCGGGTGGTTGAGATCGGGATCGTCGAGGACCACCGCCTCAGAGATCGAC
GGAGGGGCTATCACGGAGAGAGATGCAAGGAGAATTAGGGCCAACCTTCAGCGGTCAAAATCAAGCGCTGAGCGGGCACTGAAGGGGCTCAAGTTCATAAGCAAGGCCAGTAGTAGCACG
GTGGCCGGTGGGGGCGGCGACGCCGAGCAGCTGTGGCGGCGAGTCGAGTCTCGGTTTGACTCACTGTCGTCCAGAGACGGATTCCTCGCAAGGGATGATTTTGGCGAGTGCATAG
GTGCG
TATTAATTGCTGAATTTGGATGATCGATATATCAGGTACAATTCCACCATTAATTAATAGTAGGATGAATTGATTGGCAGGGATGGTGGATTCGAAAGAGTTCGCGGGGAGTGTGTTCGA
CGCATTGGCGAGGAGGAAAGGGCAGAGGATAAGTAGAATTACAAAGGAAGAGCTTCGGGAGTTTTGGTTGCAGATTACAGACCACAGTTTCGATGCTCGCCTCCAAATTTTCTTCGACAT
GTGAGTAGTTGCTAACTTTTTACCACTGCGTACGGTACGTTTCAGTTTGAAAACCAGTGCCATTCTTTCTTCCGGCATCCACGATGGCCGTTATCTTCAAACAGATTCCTTTCCCTTTCT
TTTTTATTTATTTTACCTATGACCTAATTAACTTTAACCAATGTTTCTTACTCTTTCGAATAATATAAATGCCGTTAAATTGAGTAACAAAAACACCATTAAATCGTTATATACTTATAT
CTAGAACAGGATTCCGACGTGTATATTGAAATTAAGATTCTCGTAGAAATATATTAATCAGAAAAAAATAACAGCTGGACATAATACTACATAAACTATCTATTGATAATGATAGATTAG
TGGCCAACTCACAATATTTTAGTTCTTTTAGCTATAAATTCAAGGTTAAACCAATTACTCTGATAATCTGTTTCTAAGTTCTAACTACTAAAATGATATTTGAACAGGGCAGACAGCAAT
GATGATGGAAGAATCACAAGGGAAGAGGTGCAGGAG
GTAATTATAAGCTGTCCATTAATTAATTATACTTCTTAATGTGTAACAAATTTAGCAAGGTCTCTAAATATGTTGAATATGGAA
AATCACGCAGTTGATAACACTGAGTGCTTCAGCTAATAAACTCTCCAAATTGAAAGAACAAGCTGAAGAATATGCAGGATTGATAATGGAGGAGCTTGATCCTGAAAATCTTGGATACAT
TGAG
GTAAATAAAATGATCTTATTTGTTATTTAAGATCCAAAAAATATTCACTGATCACCAGAGCATGGAATATTTATAGCGTGGAATTCAAGTTATGTTTTTGCCTCTAATTTATAAGA
TGATTAATTAATTGATTCCTATCCTGTATATAGTGGGTCTCCACCCACCACCAACTCATAATTAGGTTACTTTTTAGTTTACGTGATGCATTATTATTGACTTTTTGGACCTTTTTCTTT
TATAACTATTTTGAGTTTCATTAATCTCATACATTTGTTACTCACACCTCATTTTTAATTGTTCTCTAATAGTTAGTTTAATGTTGAAATCAGATCATCTTGCATCTGCCACCGTAATTG
AAACTTGTTATCAGTAAAAATCTTTATCGTCAATGTGATTTATTTACTGTCCCTGTGAATATATTACGTTTTCCTCTGTCTTGCTTTTAGTTTAGGCCTGGCACTTTGGTTGGTTATTCC
GTTTAACCGAATTCGTGTAGCCCAAAACCGAATTTGTATGTTTCAATCGAAACAGAAATCGAAAATTTGGCAATCAATTTGAATTCAGAAAATTCGGTGATTTCAGTTAAATACGAAAGC
GAAATCGGCCGCAGTTTTTTACAATATACATGGAAACATGGAATAATGAATATCAGAGAGAAGTTTTTTTTATTAATATTTACATTGATCTGAACAAATGAGGAGTGGGTTTTGATTTAT
TTACGTTTGTCTTCTTCTTCTCCTGGTAATGTATAGCTATGGCAGTTAGAAACACTACTTCTTCGAAGGGACGCATACATGAACTACAGCAGGCCACTAAGCACTGCGAGCTTAGGGTGG
AGTCAGAATTTGAGCACTAGATTTCAACCCCGAATCATGGGTCGCAGGCTTACTTCGATGCTAAGGAGCATCATTGTCGAGAACTGGCAACGTGGTTGTATATTGACTCTATGGCTAATC
CTAATGACTCTGCTCTTCGCATGGAAGTTCGTCAATTATAGAAACAGAGCTGCATTTCAAGTAATGGGCTACTGCCTCACAACTGCCAAAGGCGCTGCTGAGACTCTTAAGCTCAACATG
GCTCTAATCCTCTTGCCCGTCTGTCGAAACACCATTACCTGGCTTCGATCCACCAAAGCTAGGACCGTCATTCCTTTTGACGACAACATCAACTTCCACAAGATGATTGCAGTGTCAATA
GTAATCGGGGTTGTTCTTCACGCGGGGAACCATTTGGTCTGTGATTTCCCTCGTTTGACGAATGCCTCCCCGGAAAAGTTTTCCTTGATAGCATCTCAGTTCGACGGCAAGAAACCCACC
TACAGAGATCTTATAAGCAGCGTTGAAGGCGTGACAGGAATCTCCATGGTGGTGCTAATGGCCATTGCATTCACTCTCGCAACTAGTCAGTTCAGGAGGAATTTAGTGAAGTTGCCGGCG
CCTTTCAACAGATTGACTGGGTTCAACGCCTTCTGGTACTCTCATCACCTTACCGGAATAGTCTACATCTTGCTCTTTGTACATGGGACTTTCCTCTACCTCACTGACACGTGGTATGAC
AAAAAT
GTAAGCCTATATACAATACAACTGGAACCTGAATTTGATTGCACGTAATCTTATTTGGTATCTTAAAGTCGTCTGCTTGTTGATTTTGCAGACATGGATGTATCTTTCTGTTCC
ACTACTACTCTACGTAGTAGAGAGGACCATTCGAACGTGTCGATCAGAGCATCAGTCTGCCAAGATTATAAGG
GTAATCTGATTGATTATCAAGTTGCAGAGGGATGTTCCCTTTTCCTC
ATCATTTGATTCTCAATCGACTGTTTTTCTGCCCGGGCAGGTAACGGTTTTGCCAGGAGATGTGTTCAGCCTAACAATGTCGAAGCCACAAGGGTTTAAGTACAAGAGTGGCCAGTACAT
ATTTCTTCAATGTCCATCGATTTCTTCCTTCGAGTG
GTGAGTGGCTGAGTGTAAGGAAAAAGCTCGAATACTTGATAGGGTCACGACTAATCCATAATACAAGTAATTTCCTTCTTGTGC
AGGCATCCATTCTCGATAACCTCAGCTCCAGGAGACGAATACCTTAGTGTCCATGTCCGGATTGTGGGTGACTGGACACAAGAATTGAAGCGAGTTTTCACTGAGGTTAACGACTCACCA
ACTGTTATTGGCCGAGCTAAATTCGGTCAACTCGGCCATATGGATCATAGAGG
GTAATCACCAACTCGGAATATAAAGATAGCATACCTGTTTACATACTGAAGGCTTTCAAGCAATCTA
AAACTAAGGACTCGAAAAAAATGTTGCAGGCAACCAAAACTATATGTTGACGGTCCATATGGGGCTCCTGCACAAGACTATAAGAACTATGATGTACTGCTCCTTGTAGGGTTGGGTATT
GGGGCTACCCCTTTCATCAGCATTCTCAGAGATCTGTTAAACAACACCAGAACAACAGACTATCAGACG
GTATGTTCGCCCCACACAATGCATAATTAAATTAATGGATGAGATATTAAG
CTTTTTCTACAGTTTCCGTTTCAATTTTGTTTATGAGAATCGTGCAGGACTCAAATACAGATACAAGCAGATCAGATTACAGTTCAAACAGTTGCACATCTTCGAATGGGACAGGAGGGA
ACACTATTAAGAAGAAAACCGTGAGAACCACCAACGCTCACTTCTACTGGGTTACAAGAGAACCAGGGTCATTTGAATGGTTTAAAGGAGTCATGGACGAAGTTGCAGAAATGGACCACA
AA
GTAAATTCACAAGCACATCAAATCTCCATCTCTGAATCTTCATTGTCAATATAAAAATATGGTTTCTGACATGGCTCATTCTTTTGTAAATAAATGGAAAGGGCCAAATTGAGATGCA
CAACTACTTGACAAGTGTATACGAAGAAGGTGATGCAAGGTCAACTTTGATTACCATGGTTCAAGCGCTTAACCACGCCAAACATGGAGTTGACATCGTTTCTGGCACTAGA
GTATGAAA
CATATCTTATCTCGTTGTCACATCTCAGATAATAGAAAATTGGCATTTACAGAACTGTTTTACAGGTAAGAACACACTTCGCCAGACCAAATTGGAGAGAAGTTTTCACCAAAATAGCTT
CAAAGCATCCGTTCGCAACAATAG
GTAAACAAACAGAAGCTGTCTGAATCTAAGTATACCTTGCAATCTGAGACGTAAACTTATACTGGCCAAAACTGCAGGGGTGTTCTATTGCGGGAT
GCCTACGTTAGCAAAGGAGCTAAAGAAGCTAAGTCAAGAGATGAGTCATAGGACGTCTACACGGTTCGAATTTCACAAGGAATACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGAGCTTATCTGCAAGCACCAGGCAAAGGAAGACTTATCTGCCACATCCAGGATAAGGAAGAAGTTCGGGTGGTTGAGATCGGGATCGTCGAGGACCACCGCCTCAGAGATCGAC
GGAGGGGCTATCACGGAGAGAGATGCAAGGAGAATTAGGGCCAACCTTCAGCGGTCAAAATCAAGCGCTGAGCGGGCACTGAAGGGGCTCAAGTTCATAAGCAAGGCCAGTAGTAGCACG
GTGGCCGGTGGGGGCGGCGACGCCGAGCAGCTGTGGCGGCGAGTCGAGTCTCGGTTTGACTCACTGTCGTCCAGAGACGGATTCCTCGCAAGGGATGATTTTGGCGAGTGCATAG
GGATG
GTGGATTCGAAAGAGTTCGCGGGGAGTGTGTTCGACGCATTGGCGAGGAGGAAAGGGCAGAGGATAAGTAGAATTACAAAGGAAGAGCTTCGGGAGTTTTGGTTGCAGATTACAGACCAC
AGTTTCGATGCTCGCCTCCAAATTTTCTTCGACAT
GGCAGACAGCAATGATGATGGAAGAATCACAAGGGAAGAGGTGCAGGAGTTGATAACACTGAGTGCTTCAGCTAATAAACTCTCC
AAATTGAAAGAACAAGCTGAAGAATATGCAGGATTGATAATGGAGGAGCTTGATCCTGAAAATCTTGGATACATTGAG
CTATGGCAGTTAGAAACACTACTTCTTCGAAGGGACGCATAC
ATGAACTACAGCAGGCCACTAAGCACTGCGAGCTTAGGGTGGAGTCAGAATTTGAGCACTAGATTTCAACCCCGAATCATGGGTCGCAGGCTTACTTCGATGCTAAGGAGCATCATTGTC
GAGAACTGGCAACGTGGTTGTATATTGACTCTATGGCTAATCCTAATGACTCTGCTCTTCGCATGGAAGTTCGTCAATTATAGAAACAGAGCTGCATTTCAAGTAATGGGCTACTGCCTC
ACAACTGCCAAAGGCGCTGCTGAGACTCTTAAGCTCAACATGGCTCTAATCCTCTTGCCCGTCTGTCGAAACACCATTACCTGGCTTCGATCCACCAAAGCTAGGACCGTCATTCCTTTT
GACGACAACATCAACTTCCACAAGATGATTGCAGTGTCAATAGTAATCGGGGTTGTTCTTCACGCGGGGAACCATTTGGTCTGTGATTTCCCTCGTTTGACGAATGCCTCCCCGGAAAAG
TTTTCCTTGATAGCATCTCAGTTCGACGGCAAGAAACCCACCTACAGAGATCTTATAAGCAGCGTTGAAGGCGTGACAGGAATCTCCATGGTGGTGCTAATGGCCATTGCATTCACTCTC
GCAACTAGTCAGTTCAGGAGGAATTTAGTGAAGTTGCCGGCGCCTTTCAACAGATTGACTGGGTTCAACGCCTTCTGGTACTCTCATCACCTTACCGGAATAGTCTACATCTTGCTCTTT
GTACATGGGACTTTCCTCTACCTCACTGACACGTGGTATGACAAAAAT
ACATGGATGTATCTTTCTGTTCCACTACTACTCTACGTAGTAGAGAGGACCATTCGAACGTGTCGATCAGAG
CATCAGTCTGCCAAGATTATAAGG
GTAACGGTTTTGCCAGGAGATGTGTTCAGCCTAACAATGTCGAAGCCACAAGGGTTTAAGTACAAGAGTGGCCAGTACATATTTCTTCAATGTCCA
TCGATTTCTTCCTTCGAGTG
GCATCCATTCTCGATAACCTCAGCTCCAGGAGACGAATACCTTAGTGTCCATGTCCGGATTGTGGGTGACTGGACACAAGAATTGAAGCGAGTTTTCACT
GAGGTTAACGACTCACCAACTGTTATTGGCCGAGCTAAATTCGGTCAACTCGGCCATATGGATCATAGAGG
GCAACCAAAACTATATGTTGACGGTCCATATGGGGCTCCTGCACAAGAC
TATAAGAACTATGATGTACTGCTCCTTGTAGGGTTGGGTATTGGGGCTACCCCTTTCATCAGCATTCTCAGAGATCTGTTAAACAACACCAGAACAACAGACTATCAGACG
GACTCAAAT
ACAGATACAAGCAGATCAGATTACAGTTCAAACAGTTGCACATCTTCGAATGGGACAGGAGGGAACACTATTAAGAAGAAAACCGTGAGAACCACCAACGCTCACTTCTACTGGGTTACA
AGAGAACCAGGGTCATTTGAATGGTTTAAAGGAGTCATGGACGAAGTTGCAGAAATGGACCACAAA
GGCCAAATTGAGATGCACAACTACTTGACAAGTGTATACGAAGAAGGTGATGCA
AGGTCAACTTTGATTACCATGGTTCAAGCGCTTAACCACGCCAAACATGGAGTTGACATCGTTTCTGGCACTAGA
GTAAGAACACACTTCGCCAGACCAAATTGGAGAGAAGTTTTCACC
AAAATAGCTTCAAAGCATCCGTTCGCAACAATAG
GGGTGTTCTATTGCGGGATGCCTACGTTAGCAAAGGAGCTAAAGAAGCTAAGTCAAGAGATGAGTCATAGGACGTCTACACGGTTC
GAATTTCACAAGGAATACTTCTGA

Retrieve as FASTA