Entry information : LuRboh189(Lus10034890|PACid:23142180)
Entry ID 12205
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh189(Lus10034890|PACid:23142180)
Name LuRboh189(Lus10034890|PACid:23142180)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh189
start..stop
S start..stop
LuRboh184 1675 0 114..955 14..847
PtRboh09 1436 0 1..955 1..926
VvRboh07 1389 0 1..955 1..917
CclRboh04 1333 0 18..955 12..910
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1474377..1475055 679 N° 2 1475138..1475297 160 N° 3 1475935..1475983 49 N° 4 1476080..1476193 114
N° 5 1476867..1477676 810 N° 6 1477761..1477856 96 N° 7 1477944..1478059 116 N° 8 1478147..1478317 171
N° 9 1478414..1478573 160 N° 10 1478686..1478880 195 N° 11 1478982..1479110 129 N° 12 1479184..1479262 79
N° 13 1479340..1479449 110  
join(1474377..1475055,1475138..1475297,1475935..1475983,1476080..1476193,1476867 ..1477676,1477761..1477856,1477944..1478059,1478147..1478317,1478414..1478573,14 78686..1478880,1478982..1479110,1479184..1479262,1479340..1479449)


exon

Literature and cross-references LuRboh189(Lus10034890|PACid:23142180)
DNA ref. Phytozome 11:   scaffold66 (1474377..1479449)
Protein sequence: LuRboh189(Lus10034890|PACid:23142180)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   956
PWM (Da):   %s   107773.71 Transmb domain:   %s   o391-413i526-548o574-596i754-771o
PI (pH):   %s   9.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSSSPSFARSTSGKLSNYARSFDLPDDDDNDDCDSELGDVSTGSMLPIFLNDIRRNHRNELVEITLELDDDSTIVLCSVTPPPTATPSGSAAAPTPAASTPDHHPNKSLWRSLSATSRIRKKFGWLRSGSSRTTASEIDGRVITERDARRIRANLQRSKSSAERALKGLKFISKASSSTAAGGGGEAEQLVGGDAERRWRRVESRFDSLSSIDGFLARDDFGECIGMVDSKEFAGSIFDALARRKGQRISRITKAELREFWLQITDNSFDARLQIFFDMADSNDDGRITRDEVQLITLSASANKLSKLKEQAEEYAGLIMEELDPENLGYIELWQLETLLLRRDAYMNYSRPLSTASSRWSQNLSTRFQPQIMGRRLTFMLRSIIVENWQRGCILTLWLMLMTLLFAWKFVNYRNRAAFRVMGYCLATAKGAAETLKLNMALILLPVCRNTITWLRSTKVRTVIPFDDNINFHKMIAVSIIIGVVLHAGNHLVCDFPRLTNASPEKFSLIASDFDGNKPTYRDLISGVEGMTGISMVVLMAIAFTLATSQFRRNLVKLPAPFNRLTGFNAFWYSHHLTGIVYILLFVHGTFLYLTDKWYDKNTWMYLSVPLLLYVVERTIRTCRSEHQSAKIIRVTVLPGDVFSLTMSKPQGFKYKSGQYIFLQCPSISPFEWHPFSITSAPGDEYLSVHVRIVGDWTQELKRVFTEVNDSPTVIGRAKFGQLGHMDHRGQPKLFVDGPYGAPAQDYKNYDVLLLVGLGIGATPFISILRDLLNNTRTTDYQDSNTDTSRSDYSSNSCASSNGTGGNTIKKKTVRTTNAHFYWVTREPGSFEWFKGVMDEVAEMDHKGQIEMHNYLTSVYEEGDARSTLITMVQALNHAKHGVDIVSGTRVRTHFARPNWREVFTKIASKHPFATIGVFYCGMPMLAKELKKLSQEMSHRTSTRFEFHKEYF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGATCATCATCTCCTTCCTTCGCCAGAAGCACCTCCGGCAAGCTCTCCAATTACGCTCGCTCCTTTGACTTGCCTGATGACGACGATAACGATGATTGCGACTCCGAACTCGGTGAC
GTCAGCACTGGCTCAATGCTGCCCATCTTCCTCAACGACATCAGGCGAAACCACCGCAATGAGCTGGTGGAGATCACGCTGGAGTTAGATGACGACTCCACCATTGTTCTCTGCAGCGTC
ACGCCGCCGCCTACAGCTACTCCGTCAGGCTCAGCTGCCGCCCCCACTCCTGCCGCCTCCACTCCTGATCATCACCCGAACAAGAGCCTCTGGAGGAGCTTATCTGCCACATCCAGGATA
AGGAAGAAGTTCGGGTGGTTGAGATCGGGATCGTCGAGGACCACCGCCTCAGAGATCGACGGAAGGGTTATCACGGAGAGAGATGCAAGGAGAATCAGGGCCAACCTCCAGCGGTCAAAG
TCAAGCGCGGAGCGGGCACTGAAGGGGCTCAAGTTCATAAGCAAGGCCAGCAGCAGCACGGCAGCCGGTGGGGGCGGCGAGGCCGAGCAGCTGGTGGGGGGGGACGCCGAGCGGCGGTGG
CGGCGAGTCGAGTCTCGGTTTGACTCTCTGTCGTCCATAGACGGATTCCTCGCAAGGGATGATTTCGGAGAGTGCATAG
GTATTTTGGATTAATTGCAGATTTTGGATGATCGGTATTAT
CAGGTATACAGTAAAGAATTCATTAAATTGATTGGGTGCAGGGATGGTGGATTCGAAAGAGTTCGCGGGGAGTATATTCGACGCATTGGCGAGGAGGAAAGGGCAGAGGATAAGTAGAAT
TACAAAGGCAGAGCTTCGGGAGTTTTGGTTGCAGATTACAGACAATAGTTTTGATGCACGCTTACAAATTTTCTTCGACAT
GTGAGTAGCCTTTACCACTACCTTGGGCCGGAATCAGTG
GCCGGCCGGGGCCCTCTCGGCCGAAACAAGCGGCTGGCCGGGGCCTTCTGATACCCTCTTTTTTCGATTTCGTACCTGTAACGTTCGCTTCCGATCTTCGATTTCTTCTTTGGATCAATG
TTTGAGAGTGTTTGTGAGTGTTTGATTGTGTTTGAACTAGTCAATACACACAACTTATATGGATTTCGATTTTACGAAAGGATAATATTGTAATTTACTCAAATTAGGGCGTCGTTTAAT
TTGAAACTTAGGGCGTCAAATAGGGATTCAGTTTTTTTTTACCTGACCTAATTAACTTTAACCAATGTTTTTCTCTTTCGAATAATATAAAAGTCATTAAATTGTGTAACAAAAATGTCA
TTAAATCGTTATATACTTATATCTAGAACAAGATTCCGATGTATATATTGAAATTAAAATTTTCGTGGAAATAAATTAATTTGAAAATAGTAACAGCTGAACACAAACTATCTATTATTG
ATAGATTAGTGACCAATAACTCACAATATTTTAGTTCTTTTAGCTATAAATTCAAGGTTAAACCAGTTACTTTGATAATCTGTTTCTAAGGCTAACTAATAAAATGATAATTGAACAGGG
CAGACAGCAATGATGATGGACGAATCACAAGGGATGAGGTGCAGGAG
GTAATTATAAACGGTCCATAAATAATTATATTTCTTATTGTGTAACCAATTTAATTAGCAATGTCTCTAAACA
TGTTGAATATGGAAAATCAACAGTTGATAACACTGAGTGCTTCAGCCAATAAACTCTCCAAATTGAAAGAACAAGCTGAAGAATATGCAGGGTTGATAATGGAGGAGCTTGATCCTGAAA
ATCTTGGATACATTGAG
GTAAATAAATTAAATTATCTTCCAACACACACAAAATCTCATTATTTGTTATTTAAGATCCAAAAATATTCAAGTTATTTATGTATTTGCCTNNNNNNNNNNN
NNNNNNNNTATTTGCCTCTAATTTATAAGATGGTGAGATTAGTTGATTAATTAATTGCTTCCCGATCAATCTTATAGTGGGTCTCCACCCCCCACCAACTCATAATTAGTTACTTTTTAG
TGTACGTGATGCATTGTTATTGTTGACTTTTTGGACCTTTATCTTTTATAACTATTTTTAGTTTCATAATCTGATCTTATACATACATTTGTTACTCACGCATCATTTTGAATTGTTCTC
TAGTAGTTAGTTTAATAATGTTGAAATCAGATCATCTTGCATTTGCCACCATAATTGAAACTTGTTTTTAGTAAAAATCTTTATCGCTCACATCACATAAGATCAGTGATTTATTATTGA
CTGTCCTGCTTTTAGTTGAGTCATGCATAATATACATGGAAACATGCAAATATGCAATAATAATTAATATCGGAGAGAATGTTTTTTTTATTAATATCTACAATGATATGAACAAATGAG
GAGTGGGTTTTGATTTATATATGCCTTCATAAGAGGGTTAAGTTAATATATGATCCTTGTTTGTCTTCTTTTTCTCCTGGTAATGGATAGCTATGGCAGTTAGAAACACTTCTTCTTCGA
AGAGACGCATACATGAACTACAGCAGGCCACTAAGCACGGCGAGCTCGAGGTGGAGTCAGAATTTGAGCACTAGATTTCAACCCCAAATCATGGGTCGCAGGCTTACTTTTATGCTAAGG
AGCATCATTGTCGAGAACTGGCAACGTGGTTGTATATTGACTCTATGGCTAATGCTAATGACTCTGCTCTTCGCATGGAAGTTCGTCAATTATAGAAACAGAGCTGCATTTCGAGTAATG
GGCTACTGCCTCGCAACTGCCAAAGGCGCTGCCGAGACTCTTAAGCTCAACATGGCTCTAATCCTCTTGCCAGTCTGTCGAAACACTATCACTTGGCTTCGATCCACCAAAGTCAGGACC
GTCATTCCTTTTGACGACAACATCAACTTCCACAAGATGATTGCAGTTTCAATAATAATCGGGGTTGTTCTACACGCGGGGAACCATTTGGTCTGTGATTTCCCTCGTTTGACGAATGCC
TCCCCGGAAAAGTTTTCCCTGATAGCATCTGATTTCGACGGCAATAAACCCACCTACAGAGATCTTATAAGCGGCGTTGAAGGCATGACAGGAATCTCCATGGTGGTCCTAATGGCCATT
GCATTTACTCTCGCAACTAGTCAGTTCAGGAGGAATTTAGTGAAGTTGCCGGCGCCTTTCAACAGATTGACTGGGTTCAACGCCTTCTGGTACTCTCATCACCTTACCGGAATAGTCTAC
ATCTTGCTGTTTGTACATGGGACTTTCCTCTACCTCACTGACAAGTGGTATGACAAAAAT
GTAAGCCTATATAACTGGAACCTTAATTTGATTGCACGTCACGTTATCTGGCATCTTAAA
GTCTTCTTCTTGTTGATTTTGCAGACATGGATGTATCTATCTGTTCCGCTACTGCTCTACGTAGTAGAGAGGACCATTCGAACATGTCGATCAGAGCATCAGTCTGCCAAGATTATAAGG
GTAATCTGATTGATTATCAAGTTGCAGAGAGTTTTTCCCTGTTCCTCATCATTTGATTCTCAATCGACTATTACTCTCTCCGGGCAGGTAACTGTTTTGCCAGGAGATGTTTTCAGCTTA
ACAATGTCGAAGCCACAAGGGTTTAAGTACAAGAGCGGCCAGTACATATTTCTTCAATGTCCATCCATTTCTCCCTTCGAGTG
GTGAGTGTGCATATTGTAAGGATAAGGCTGGAATACT
TAATAGGGTCACGACTAATCCATATACATCAAACTTTCCTTCTTATGCAGGCATCCATTCTCGATAACCTCAGCTCCAGGAGACGAATACCTTAGTGTCCATGTCCGGATTGTGGGTGAC
TGGACACAAGAATTGAAGCGAGTTTTCACTGAGGTTAACGACTCACCAACTGTTATTGGCCGAGCTAAATTCGGTCAACTTGGCCATATGGATCATAGAGG
GTAATCACCAACCCGAATA
TAAAGATAGCATACCTGTTTACATACAGAAAGCGTTCAAGCAATCTAAAACTAAGGTCTCAAAAAAAATTGTTGCAGGCAACCAAAACTGTTTGTTGACGGTCCATATGGGGCTCCCGCA
CAAGACTATAAGAACTATGATGTACTGCTCCTTGTAGGGTTGGGTATTGGGGCTACCCCTTTCATCAGCATTCTCAGAGATCTGTTAAACAACACCAGAACAACAGACTATCAGACG
GTA
TGTTCGCCCCACACAATGCATAATCCACAATGCAGAATTAAATTAATGGATTAGATATTAAGCTTCTTCTACAGTTTCCGTTTCAATTTTGTTTACGAGAATGGTGCAGGACTCAAATAC
AGATACAAGCAGATCAGATTACAGTTCAAACAGTTGTGCATCTTCGAATGGGACAGGAGGGAACACTATTAAGAAGAAAACCGTGAGAACAACCAACGCTCACTTCTACTGGGTTACAAG
AGAACCAGGGTCATTTGAATGGTTTAAAGGAGTCATGGACGAAGTTGCAGAAATGGACCACAAA
GTAAATTCACAAGCACATCAAATCTCCATCTCTGGATCTTCATCGTCAATATAAAA
ATATGGTTTCTGACATGGCTCATTTTTTTGTAAATAAATGGAAAGGGCCAAATTGAGATGCACAACTACTTGACAAGTGTATACGAAGAGGGTGATGCAAGGTCAACTTTGATTACCATG
GTTCAAGCGCTCAACCACGCCAAACATGGAGTTGACATCGTTTCTGGCACTAGA
GTATGAAACATATCTTATCTCCTTGTCACATCTCAGATAATAGAAAATTGGCATTTACAAAACTGT
TTTACAGGTAAGAACACACTTCGCCAGACCAAATTGGAGAGAAGTTTTCACCAAAATAGCTTCAAAGCATCCATTCGCAACAATAGGTAAGCAAACAGAAGCTGTCTGAATCTAAGTATA
CCTTGCAATCTGAGATGCAAACTTATACCGGCCAAAACTGCAGGGGTGTTCTATTGCGGGATGCCTATGTTAGCAAAGGAGCTAAAGAAGCTAAGTCAAGAGATGAGTCATAGGACGTCT
ACAAGGTTCGAATTTCACAAGGAATACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGATCATCATCTCCTTCCTTCGCCAGAAGCACCTCCGGCAAGCTCTCCAATTACGCTCGCTCCTTTGACTTGCCTGATGACGACGATAACGATGATTGCGACTCCGAACTCGGTGAC
GTCAGCACTGGCTCAATGCTGCCCATCTTCCTCAACGACATCAGGCGAAACCACCGCAATGAGCTGGTGGAGATCACGCTGGAGTTAGATGACGACTCCACCATTGTTCTCTGCAGCGTC
ACGCCGCCGCCTACAGCTACTCCGTCAGGCTCAGCTGCCGCCCCCACTCCTGCCGCCTCCACTCCTGATCATCACCCGAACAAGAGCCTCTGGAGGAGCTTATCTGCCACATCCAGGATA
AGGAAGAAGTTCGGGTGGTTGAGATCGGGATCGTCGAGGACCACCGCCTCAGAGATCGACGGAAGGGTTATCACGGAGAGAGATGCAAGGAGAATCAGGGCCAACCTCCAGCGGTCAAAG
TCAAGCGCGGAGCGGGCACTGAAGGGGCTCAAGTTCATAAGCAAGGCCAGCAGCAGCACGGCAGCCGGTGGGGGCGGCGAGGCCGAGCAGCTGGTGGGGGGGGACGCCGAGCGGCGGTGG
CGGCGAGTCGAGTCTCGGTTTGACTCTCTGTCGTCCATAGACGGATTCCTCGCAAGGGATGATTTCGGAGAGTGCATAG
GGATGGTGGATTCGAAAGAGTTCGCGGGGAGTATATTCGAC
GCATTGGCGAGGAGGAAAGGGCAGAGGATAAGTAGAATTACAAAGGCAGAGCTTCGGGAGTTTTGGTTGCAGATTACAGACAATAGTTTTGATGCACGCTTACAAATTTTCTTCGACAT
G
GCAGACAGCAATGATGATGGACGAATCACAAGGGATGAGGTGCAGGAG
TTGATAACACTGAGTGCTTCAGCCAATAAACTCTCCAAATTGAAAGAACAAGCTGAAGAATATGCAGGGTTG
ATAATGGAGGAGCTTGATCCTGAAAATCTTGGATACATTGAG
CTATGGCAGTTAGAAACACTTCTTCTTCGAAGAGACGCATACATGAACTACAGCAGGCCACTAAGCACGGCGAGCTCG
AGGTGGAGTCAGAATTTGAGCACTAGATTTCAACCCCAAATCATGGGTCGCAGGCTTACTTTTATGCTAAGGAGCATCATTGTCGAGAACTGGCAACGTGGTTGTATATTGACTCTATGG
CTAATGCTAATGACTCTGCTCTTCGCATGGAAGTTCGTCAATTATAGAAACAGAGCTGCATTTCGAGTAATGGGCTACTGCCTCGCAACTGCCAAAGGCGCTGCCGAGACTCTTAAGCTC
AACATGGCTCTAATCCTCTTGCCAGTCTGTCGAAACACTATCACTTGGCTTCGATCCACCAAAGTCAGGACCGTCATTCCTTTTGACGACAACATCAACTTCCACAAGATGATTGCAGTT
TCAATAATAATCGGGGTTGTTCTACACGCGGGGAACCATTTGGTCTGTGATTTCCCTCGTTTGACGAATGCCTCCCCGGAAAAGTTTTCCCTGATAGCATCTGATTTCGACGGCAATAAA
CCCACCTACAGAGATCTTATAAGCGGCGTTGAAGGCATGACAGGAATCTCCATGGTGGTCCTAATGGCCATTGCATTTACTCTCGCAACTAGTCAGTTCAGGAGGAATTTAGTGAAGTTG
CCGGCGCCTTTCAACAGATTGACTGGGTTCAACGCCTTCTGGTACTCTCATCACCTTACCGGAATAGTCTACATCTTGCTGTTTGTACATGGGACTTTCCTCTACCTCACTGACAAGTGG
TATGACAAAAAT
ACATGGATGTATCTATCTGTTCCGCTACTGCTCTACGTAGTAGAGAGGACCATTCGAACATGTCGATCAGAGCATCAGTCTGCCAAGATTATAAGGGTAACTGTTTTG
CCAGGAGATGTTTTCAGCTTAACAATGTCGAAGCCACAAGGGTTTAAGTACAAGAGCGGCCAGTACATATTTCTTCAATGTCCATCCATTTCTCCCTTCGAGTG
GCATCCATTCTCGATA
ACCTCAGCTCCAGGAGACGAATACCTTAGTGTCCATGTCCGGATTGTGGGTGACTGGACACAAGAATTGAAGCGAGTTTTCACTGAGGTTAACGACTCACCAACTGTTATTGGCCGAGCT
AAATTCGGTCAACTTGGCCATATGGATCATAGAGG
GCAACCAAAACTGTTTGTTGACGGTCCATATGGGGCTCCCGCACAAGACTATAAGAACTATGATGTACTGCTCCTTGTAGGGTTG
GGTATTGGGGCTACCCCTTTCATCAGCATTCTCAGAGATCTGTTAAACAACACCAGAACAACAGACTATCAGACG
GACTCAAATACAGATACAAGCAGATCAGATTACAGTTCAAACAGT
TGTGCATCTTCGAATGGGACAGGAGGGAACACTATTAAGAAGAAAACCGTGAGAACAACCAACGCTCACTTCTACTGGGTTACAAGAGAACCAGGGTCATTTGAATGGTTTAAAGGAGTC
ATGGACGAAGTTGCAGAAATGGACCACAAA
GGCCAAATTGAGATGCACAACTACTTGACAAGTGTATACGAAGAGGGTGATGCAAGGTCAACTTTGATTACCATGGTTCAAGCGCTCAAC
CACGCCAAACATGGAGTTGACATCGTTTCTGGCACTAGA
GTAAGAACACACTTCGCCAGACCAAATTGGAGAGAAGTTTTCACCAAAATAGCTTCAAAGCATCCATTCGCAACAATAGGG
GTGTTCTATTGCGGGATGCCTATGTTAGCAAAGGAGCTAAAGAAGCTAAGTCAAGAGATGAGTCATAGGACGTCTACAAGGTTCGAATTTCACAAGGAATACTTCTGA

Retrieve as FASTA