Entry information : LuRboh96(Lus10017850|PACid:23148819)
Entry ID 12208
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh96(Lus10017850|PACid:23148819)
Name LuRboh96(Lus10017850|PACid:23148819)
Class Respiratory burst oxidase homolog     [Orthogroup: Rboh001]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh96
start..stop
S start..stop
LuRboh216 1421 0 35..845 17..781
MtRboh06 912 0 38..845 62..815
EgrRboh07 894 0 49..845 54..796
CsRboh07 872 0 61..845 69..784
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 319205..319553 349 N° 2 318899..319109 211 N° 3 318649..318811 163 N° 4 318177..318572 396
N° 5 317421..317807 387 N° 6 317232..317327 96 N° 7 316922..317140 219 N° 8 316675..316836 162
N° 9 316337..316600 264 N° 10 315954..316244 291  
complement(join(315954..316244,316337..316600,316675..316836,316922..317140,3172 32..317327,317421..317807,318177..318572,318649..318811,318899..319109,319205..3 19553))


exon

Literature and cross-references LuRboh96(Lus10017850|PACid:23148819)
DNA ref. Phytozome 11:   scaffold35 (319553..315954)
Protein sequence: LuRboh96(Lus10017850|PACid:23148819)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   845
PWM (Da):   %s   95301.31 Transmb domain:   %s   o290-309i374-393o424-446i471-493o503-520i790-812o
PI (pH):   %s   9.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAGHSINAPAARASVSTSSLSSSSSSSSSSSSSIQMQHQHCSYLLDNGRLEGGQPSPNSIRFIDIGWEEVENRFNRLVIVREGSQPTVKGADFGYCVGIKDDPFMIVAGSDMINCRLQQCPEFAGQLLRALRGKRSSSSRRRIIKTDEEDSNYGSGITIRELYSHWHRLTSSSFSFQSSSNLVFDICDRDMDGKINQADIKQGILLSASTNRLCVTHEEAQEHAASIMEVLDSTRCGYIPNELEALLRTTLPGSNNNSSSAKLVVNDNNQEVSKTKAEMVFRAYWRRSWILLLWLIICFSLFTWKFIQYKHRMAFQVMGYCLSTAKGAAETLKFNMALILLPVCRNTITWIRRSTRINSVVPFNDNINFHKIVGGGIVIGVILHGGTHLACDFPRISGSDKATFRQTIAADFAYHQPSYVEILATTEVATGIAMVLLMAVAFALATSWPRRQSASLPKSVRKITGYNTFWYSHHLLILVYALLIVHSMFLFLTNNLFEKTTWMYIAFPVILYGGERVWRAIRSDSYNVQVLEASMFPGKVLHLKLQKPQGFKYKSGMYIFIQCPQISKLQWHPFSLTSGPKDEHLSVHMRALGDWSYEVYGLFQEVILSGRKEFPQIYIDGGYGAPSQDHVKYDVVLMIGLGIGATPFISILKDIRSQQDGSEENRRGKGPLRAYFYWVTREQSSFDWFRDSLRDITTSNQNMVSVIEVNNFLTTAHEEGDARSALITAAQALHRAKTGLDMLSRYQEARTHFGRPNWFSIFSKLATRHKRERIGKNINRKEPIKFQYCSAPTVCFSYTIAMLCVGAGVFYCGPSALGKELEELCTKFSTKTPTRFVFHKEHY*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. 5' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTGGTCATAGTATTAATGCACCAGCTGCAAGGGCTTCTGTTTCAACATCATCTTTATCCTCTTCAAGTTCTTCTTCCTCTTCCTCCTCTAGTTCAATACAGATGCAGCATCAA
CATTGCAGTTACTTGCTGGATAATGGTCGTTTAGAAGGAGGCCAGCCATCTCCCAATTCAATAAGGTTCATAGACATTGGTTGGGAGGAGGTGGAGAACCGGTTCAACCGGCTGGTTATT
GTCAGGGAAGGGTCTCAACCAACGGTCAAAGGGGCTGATTTTGGCTACTGTGTAGGTATAAAGGATGACCCTTTTATGATTGTTGCAGGTTCTGACATGATCAACTGCA
GTAAAACATTG
AATAGGCATATAAAAGTCTGTGTTCTGTGCATTTTGATTTTGTGGTGAAAGCTCTAGTTGTGATTTTTGGTTCTTCTACTGCAGGGCTGCAACAGTGTCCTGAGTTTGCAGGTCAGCTTT
TGAGGGCATTAAGAGGGAAAAGAAGCAGCAGCAGCAGAAGAAGAATAATAAAAACAGATGAAGAAGATTCCAACTATGGTAGTGGAATCACAATAAGAGAACTTTATAGCCATTGGCATC
GGCTGACTTCTTCTAGTTTCAGTTTCCAATCAAGCTCCAACCTTGTATTTGACAT
GTATATAATGCTTAACTTACCCTTGAGATTAGAGACAGTTAGTAACTTTTTCTTAACTGAAGCTT
TCAATTGATGTTACACACTCAGATGTGACAGAGATATGGATGGAAAGATTAACCAGGCGGACATTAAGCAAGGAATATTGCTAAGTGCTTCAACGAATAGACTGTGTGTAACACATGAGG
AAGCACAAGAACATGCTGCTTCAATCATGGAGGTTCTAGATTCAACAAGATGTGGCTACATTGAG
GTATACCAACATCTGATAAAATCTTCCTTCAAGTATACAACATCACTTCAGGATT
TAACTTCAGCCCTATTGTTAGCCTAATGAACTAGAAGCACTACTCAGAACAACCTTGCCAGGAAGCAACAACAACAGCAGCAGTGCAAAACTTGTTGTCAATGACAACAACCAAGAAGTG
TCGAAAACCAAGGCGGAAATGGTGTTTAGGGCTTATTGGAGGAGATCATGGATATTGTTGCTGTGGTTGATCATCTGCTTCTCACTATTCACATGGAAGTTCATTCAGTACAAGCACAGA
ATGGCATTTCAGGTAATGGGGTATTGCCTTTCCACTGCCAAAGGTGCAGCTGAGACACTCAAATTCAACATGGCTTTGATTCTCCTCCCCGTTTGCCGAAACACCATCACTTGGATTAGG
AGAAGCACAAGGATCAACTCTGTTGTTCCATTCAATGACAACATCAACTTCCACAAG
GTAAGCATTTAAGGGGTCGTTTGGATGAGTTATTTTGCATGTGTGTGTGTGGTGTTTGGAGCA
AAATGATGCATTATTATTTGAGAATGTGAGAGATTTATGAGATGCAAAGGGGTTATGGTGCGGGAATTATCATGTTTAGCTAATGAGTCAATTCAATGTGGTATTTGCTAAACGGAAAGG
CCAAAGTACTCGAAATACCGTGTGTGGGGGGAGGTATATTTTTGTTCGATGTCAAATGAGTTATTTTGATCCAAATAACTCACCCAAACGACCCGTAAAGGTGTCAAACGCGCTACTTAG
GTATAAATTTAGGGTTGGTTACCCTTTGAGTGACTCAATAATATCTTGTTGGTGTGTGTTCATCAGATAGTTGGTGGAGGAATAGTGATTGGAGTAATACTACATGGTGGAACACATCTT
GCTTGTGACTTCCCAAGAATAAGTGGCTCAGACAAGGCAACTTTCAGGCAAACCATAGCAGCCGATTTTGCTTATCACCAACCTTCATATGTCGAGATATTGGCCACCACAGAGGTTGCA
ACTGGGATTGCAATGGTATTACTAATGGCGGTTGCATTCGCTCTGGCGACAAGCTGGCCTCGTCGCCAGTCAGCTTCGCTTCCGAAGTCTGTCAGAAAAATAACTGGTTACAACACATTT
TGGTACTCTCACCATTTGCTCATACTTGTCTATGCTCTCCTCATTGTTCACTCCATGTTCCTCTTCCTCACCAACAATCTCTTTGAGAAGACC
GTGAGTTCTTTGTTTCTCTATTCCTTC
TTTGTGCCTTAATGTGTAAAGAGGGTAGTGCTAATAAACTGCAAAAAGGTTTGATCTTTGTTGCAGACATGGATGTACATTGCCTTCCCAGTGATCCTATATGGTGGCGAACGCGTATGG
AGAGCCATTAGATCAGATTCTTATAATGTACAAGTTCTGGAA
GTAAGTACATAAATCTGAATGGTGGATGATAGCCTGTGGGATGAGATTCCAAAACATTGGACTGATTTTTTTATGCCT
TTGTGCAATGCAGGCAAGCATGTTCCCTGGAAAGGTTTTGCATCTGAAGCTGCAGAAACCTCAAGGTTTCAAGTACAAGAGTGGGATGTACATCTTCATACAGTGCCCTCAGATTTCTAA
GCTTCAGTGGCACCCATTTTCATTAACTTCAGGGCCTAAAGATGAGCACTTGAGTGTCCACATGAGAGCTCTTGGTGATTGGAGCTATGAAGTATATGGTCTCTTCCAAGAG
GTGATAAA
TTGAACAAAGTTAACAAAACAGCAGAATTAATTAAAAAATTAAGCTCAACCTGGGTTTTTTCCCCCACCATTGTTAGGTAATACTATCTGGAAGGAAGGAGTTTCCACAGATATACATAG
ATGGAGGATATGGAGCTCCATCTCAAGACCATGTTAAGTATGATGTTGTCCTGATGATTGGTCTTGGCATTGGAGCTACACCCTTTATTAGTATCCTCAAAGACATAAGATCTCAGCAG
G
TGCGTAAGATTATCAGCCTTTATCTTTCTGTATAAAATTTGAGCTTTCTTGAACACTGAACCATGAAAAGCAGGATGGCAGTGAAGAAAACAGAAGGGGAAAGGGTCCTTTAAGAGCCTA
CTTCTACTGGGTGACAAGGGAGCAAAGTTCATTTGATTGGTTCAGAGACAGTCTGAGGGACATAACCACGTCAAATCAAAACATGGTTAGTGTGATTGAGGTGAACAACTTCTTGACAAC
AGCACATGAAGAAGGAGATGCAAGGTCAGCTCTGATCACTGCAGCACAAGCACTGCATCGTGCCAAGACCGGCCTCGACATGTTGTCCCGGTATCAG
GTAAAACACTGGTGCGACGGTTC
AGATTGGTTCCTATATTATTCATTAACATCAAAGTCTGATAGTCTTGAACCCGAAATGGGGAGTTTCAGGAGGCTAGGACGCATTTTGGTCGACCTAACTGGTTCAGCATCTTCTCAAAG
CTTGCTACAAGACACAAACGAGAGAGGATTGGTAAGAACATTAACAGAAAGGAACCGATTAAGTTTCAGTACTGCAGTGCACCGACTGTATGTTTTTCATATACAATTGCGATGCTTTGT
GTGGGCGCAGGAGTGTTCTACTGTGGACCGTCAGCGCTAGGAAAAGAGTTAGAGGAGCTATGTACTAAATTCTCAACCAAAACACCCACTCGATTTGTTTTCCACAAGGAACATTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTGGTCATAGTATTAATGCACCAGCTGCAAGGGCTTCTGTTTCAACATCATCTTTATCCTCTTCAAGTTCTTCTTCCTCTTCCTCCTCTAGTTCAATACAGATGCAGCATCAA
CATTGCAGTTACTTGCTGGATAATGGTCGTTTAGAAGGAGGCCAGCCATCTCCCAATTCAATAAGGTTCATAGACATTGGTTGGGAGGAGGTGGAGAACCGGTTCAACCGGCTGGTTATT
GTCAGGGAAGGGTCTCAACCAACGGTCAAAGGGGCTGATTTTGGCTACTGTGTAGGTATAAAGGATGACCCTTTTATGATTGTTGCAGGTTCTGACATGATCAACTGCA
GGCTGCAACAG
TGTCCTGAGTTTGCAGGTCAGCTTTTGAGGGCATTAAGAGGGAAAAGAAGCAGCAGCAGCAGAAGAAGAATAATAAAAACAGATGAAGAAGATTCCAACTATGGTAGTGGAATCACAATA
AGAGAACTTTATAGCCATTGGCATCGGCTGACTTCTTCTAGTTTCAGTTTCCAATCAAGCTCCAACCTTGTATTTGACAT
ATGTGACAGAGATATGGATGGAAAGATTAACCAGGCGGAC
ATTAAGCAAGGAATATTGCTAAGTGCTTCAACGAATAGACTGTGTGTAACACATGAGGAAGCACAAGAACATGCTGCTTCAATCATGGAGGTTCTAGATTCAACAAGATGTGGCTACATT
GAG
CCTAATGAACTAGAAGCACTACTCAGAACAACCTTGCCAGGAAGCAACAACAACAGCAGCAGTGCAAAACTTGTTGTCAATGACAACAACCAAGAAGTGTCGAAAACCAAGGCGGAA
ATGGTGTTTAGGGCTTATTGGAGGAGATCATGGATATTGTTGCTGTGGTTGATCATCTGCTTCTCACTATTCACATGGAAGTTCATTCAGTACAAGCACAGAATGGCATTTCAGGTAATG
GGGTATTGCCTTTCCACTGCCAAAGGTGCAGCTGAGACACTCAAATTCAACATGGCTTTGATTCTCCTCCCCGTTTGCCGAAACACCATCACTTGGATTAGGAGAAGCACAAGGATCAAC
TCTGTTGTTCCATTCAATGACAACATCAACTTCCACAAG
ATAGTTGGTGGAGGAATAGTGATTGGAGTAATACTACATGGTGGAACACATCTTGCTTGTGACTTCCCAAGAATAAGTGGC
TCAGACAAGGCAACTTTCAGGCAAACCATAGCAGCCGATTTTGCTTATCACCAACCTTCATATGTCGAGATATTGGCCACCACAGAGGTTGCAACTGGGATTGCAATGGTATTACTAATG
GCGGTTGCATTCGCTCTGGCGACAAGCTGGCCTCGTCGCCAGTCAGCTTCGCTTCCGAAGTCTGTCAGAAAAATAACTGGTTACAACACATTTTGGTACTCTCACCATTTGCTCATACTT
GTCTATGCTCTCCTCATTGTTCACTCCATGTTCCTCTTCCTCACCAACAATCTCTTTGAGAAGACC
ACATGGATGTACATTGCCTTCCCAGTGATCCTATATGGTGGCGAACGCGTATGG
AGAGCCATTAGATCAGATTCTTATAATGTACAAGTTCTGGAA
GCAAGCATGTTCCCTGGAAAGGTTTTGCATCTGAAGCTGCAGAAACCTCAAGGTTTCAAGTACAAGAGTGGGATGTAC
ATCTTCATACAGTGCCCTCAGATTTCTAAGCTTCAGTGGCACCCATTTTCATTAACTTCAGGGCCTAAAGATGAGCACTTGAGTGTCCACATGAGAGCTCTTGGTGATTGGAGCTATGAA
GTATATGGTCTCTTCCAAGAG
GTAATACTATCTGGAAGGAAGGAGTTTCCACAGATATACATAGATGGAGGATATGGAGCTCCATCTCAAGACCATGTTAAGTATGATGTTGTCCTGATG
ATTGGTCTTGGCATTGGAGCTACACCCTTTATTAGTATCCTCAAAGACATAAGATCTCAGCAG
GATGGCAGTGAAGAAAACAGAAGGGGAAAGGGTCCTTTAAGAGCCTACTTCTACTGG
GTGACAAGGGAGCAAAGTTCATTTGATTGGTTCAGAGACAGTCTGAGGGACATAACCACGTCAAATCAAAACATGGTTAGTGTGATTGAGGTGAACAACTTCTTGACAACAGCACATGAA
GAAGGAGATGCAAGGTCAGCTCTGATCACTGCAGCACAAGCACTGCATCGTGCCAAGACCGGCCTCGACATGTTGTCCCGGTATCAG
GAGGCTAGGACGCATTTTGGTCGACCTAACTGG
TTCAGCATCTTCTCAAAGCTTGCTACAAGACACAAACGAGAGAGGATTGGTAAGAACATTAACAGAAAGGAACCGATTAAGTTTCAGTACTGCAGTGCACCGACTGTATGTTTTTCATAT
ACAATTGCGATGCTTTGTGTGGGCGCAGGAGTGTTCTACTGTGGACCGTCAGCGCTAGGAAAAGAGTTAGAGGAGCTATGTACTAAATTCTCAACCAAAACACCCACTCGATTTGTTTTC
CACAAGGAACATTACTAG

Retrieve as FASTA