Entry information : CberCcP01
Entry ID 12213
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: CberCcP01
Name CberCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Cucurbitariaceae Cucurbitaria
Organism Cucurbitaria berberidis    [TaxId: 45142 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CberCcP01
start..stop
S start..stop
Ssrc1lsm3aCcP01 681 0 1..377 1..374
LmaCcP01 674 0 1..378 1..376
AalteCcP01 671 0 1..377 1..374
PtritCcP 665 0 1..377 1..374
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 868528..868949 422 N° 2 869009..869723 715  
join(868528..868949,869009..869723)


exon

Literature and cross-references CberCcP01
DNA ref. JGI genome:   scaffold_1 (868528..869723)
Cluster/Prediction ref. JGI gene:   350030
Protein sequence: CberCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   379
PWM (Da):   %s   42554.13 Transmb domain:   %s   i65-84o
PI (pH):   %s   8.04
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRTFTRALRTAAPSFRATSTRTSARFIAPTQTAFRQQWQRGYASGKATEEEPDKYDGNPTGLIVGAFALLAGAGVYGLYTQKPELFGQEKRKTFVPRFEDYQKVYDAIAKKLEEKDDYDDGSYGPVLLRLAWHASGTYDKLTNTGGSNGATMRFAPEGDHGANAGLKAARDFLEPIKEAFPWITYSDLWILSGVCAIQEMQGPKIPYRAGRSDRDLSFCTPDGRLPDASKDRSHIRAIFGRMGFDDKAMVALSGAHALGRCHTDRSGFDGPWTFSPTTLTNDYFKLLIEEKWQYKKWNGPKQFEDVKTKTLMMLPTDMEIVKDKSFRQYAELYAKDNDAFFNDFRDAVVTLFELGVPFVHPEDQRYTFKSSFDS

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCGCGAACCTTCACCCGTGCCCTGCGCACTGCCGCACCATCCTTTCGCGCTACCTCCACCCGCACTTCGGCGCGCTTCATCGCACCTACGCAGACGGCTTTCCGCCAA
CAATGGCAACGCGGATATGCTTCAGGCAAAGCGACAGAGGAAGAGCCAGACAAATATGACGGCAACCCAACCGGTCTGATTGTTGGTGCTTTTGCTCTGCTCGCTGGTGCTGGTGTGTAC
GGTCTATACACCCAGAAGCCCGAGTTGTTCGGCCAGGAAAAGAGGAAGACCTTTGTACCCAGGTTTGAGGACTACCAGAAGGTGTATGATGCGATCGCGAAGAAGCTGGAAGAAAAGGAT
GATTATGATGATGGGAGCTATGGGCCAGTGCTGTTGAGGCTGGCCTGGCACGCTTCTGGAAC
GTACGTTTACCCCCGCTACTTTTTTTTATTGCATCAGAGCTGCGACTAACATACAGCA
GCTATGACAAGCTGACCAACACTGGTGGTTCCAACGGTGCAACCATGCGCTTCGCCCCTGAAGGCGACCACGGTGCGAACGCCGGTCTCAAAGCCGCCCGTGACTTCCTCGAGCCTATCA
AAGAGGCCTTCCCCTGGATCACGTACTCGGATCTTTGGATCCTCAGCGGTGTCTGCGCCATCCAAGAAATGCAGGGCCCCAAGATTCCGTACCGAGCAGGCCGCTCTGATCGCGACTTGA
GCTTTTGCACACCTGACGGCCGTCTGCCAGACGCGAGCAAGGACCGCAGTCACATCCGCGCCATCTTTGGTCGCATGGGTTTCGACGACAAAGCCATGGTAGCCTTATCTGGTGCCCATG
CGCTTGGACGCTGCCACACTGATCGCTCAGGCTTTGATGGCCCGTGGACCTTCTCCCCCACCACGCTCACAAACGACTACTTCAAACTCTTGATCGAGGAGAAGTGGCAGTACAAGAAGT
GGAATGGACCCAAGCAGTTCGAGGACGTCAAGACCAAGACGCTCATGATGCTACCTACCGATATGGAAATCGTTAAGGACAAGAGCTTCAGGCAGTACGCTGAGCTCTATGCCAAGGACA
ACGACGCTTTCTTTAACGATTTCAGGGATGCGGTTGTCACGCTGTTTGAGCTCGGTGTGCCGTTCGTGCACCCAGAGGATCAGAGATATACCTTCAAGAGCAGCTTCGACTCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCGCGAACCTTCACCCGTGCCCTGCGCACTGCCGCACCATCCTTTCGCGCTACCTCCACCCGCACTTCGGCGCGCTTCATCGCACCTACGCAGACGGCTTTCCGCCAA
CAATGGCAACGCGGATATGCTTCAGGCAAAGCGACAGAGGAAGAGCCAGACAAATATGACGGCAACCCAACCGGTCTGATTGTTGGTGCTTTTGCTCTGCTCGCTGGTGCTGGTGTGTAC
GGTCTATACACCCAGAAGCCCGAGTTGTTCGGCCAGGAAAAGAGGAAGACCTTTGTACCCAGGTTTGAGGACTACCAGAAGGTGTATGATGCGATCGCGAAGAAGCTGGAAGAAAAGGAT
GATTATGATGATGGGAGCTATGGGCCAGTGCTGTTGAGGCTGGCCTGGCACGCTTCTGGAAC
CTATGACAAGCTGACCAACACTGGTGGTTCCAACGGTGCAACCATGCGCTTCGCCCCT
GAAGGCGACCACGGTGCGAACGCCGGTCTCAAAGCCGCCCGTGACTTCCTCGAGCCTATCAAAGAGGCCTTCCCCTGGATCACGTACTCGGATCTTTGGATCCTCAGCGGTGTCTGCGCC
ATCCAAGAAATGCAGGGCCCCAAGATTCCGTACCGAGCAGGCCGCTCTGATCGCGACTTGAGCTTTTGCACACCTGACGGCCGTCTGCCAGACGCGAGCAAGGACCGCAGTCACATCCGC
GCCATCTTTGGTCGCATGGGTTTCGACGACAAAGCCATGGTAGCCTTATCTGGTGCCCATGCGCTTGGACGCTGCCACACTGATCGCTCAGGCTTTGATGGCCCGTGGACCTTCTCCCCC
ACCACGCTCACAAACGACTACTTCAAACTCTTGATCGAGGAGAAGTGGCAGTACAAGAAGTGGAATGGACCCAAGCAGTTCGAGGACGTCAAGACCAAGACGCTCATGATGCTACCTACC
GATATGGAAATCGTTAAGGACAAGAGCTTCAGGCAGTACGCTGAGCTCTATGCCAAGGACAACGACGCTTTCTTTAACGATTTCAGGGATGCGGTTGTCACGCTGTTTGAGCTCGGTGTG
CCGTTCGTGCACCCAGAGGATCAGAGATATACCTTCAAGAGCAGCTTCGACTCATAG

Retrieve as FASTA