Entry information : CberCIIAA01
Entry ID 12214
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: CberCIIAA01
Name CberCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Cucurbitariaceae Cucurbitaria
Organism Cucurbitaria berberidis    [TaxId: 45142 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CberCIIAA01
start..stop
S start..stop
COsaCIIAA05 711 0 1..403 1..403
CheCIIAA05_C5 710 0 1..403 1..403
CheCIIAA05_C4 710 0 1..403 1..403
SturCIIAA02 706 0 1..398 1..398
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1729685..1730674 990 N° 2 1729411..1729632 222  
complement(join(1729411..1729632,1729685..1730674))


exon

Literature and cross-references CberCIIAA01
DNA ref. JGI genome:   scaffold_4 (1730674..1729411)
Cluster/Prediction ref. JGI gene:   341154
Protein sequence: CberCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404 (383)
PWM (Da):   %s   44213.16 (41957.0)  
PI (pH):   %s   7.79 (7.09) Peptide Signal:   %s   cut: 21 range:21-403
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTLSYLSHALLACIPLSNAHPGMGEQMLEMRREANRIERRSSKELIGDLKTLADSKLTAIGKDIKAILLDQKNAESSTIDTSIPVGGIGSAACKADLCCHWKWLSYEMTAKFNGTSGRCSKFARQAVRLGFHDAAVWTKDSSYGGADGSILLSDEMSRADNNGLAAIADQTNKWYKKYNQYGLSMADIIQFGANVATVVCPLGPRVRSFVGRKDNSKAGPTGLLPGEKDSASVLLKLFQAKTIDPHDLVALVGAHTTSQQHFVNTARDGDPQDTTPGVWDVAFYPQTINNPPPRVLKFQSDINLSKDSRTSSAWTEFSDRNTGQQKWNQDYAKAYTRLSLLGVNNINDLKECTQVMPVQRNSFTSEDQVVLDRWLQGEFDQLNNMVDDAIQLTGVVTGPGKE*

Retrieve as FASTA  
Remarks complete sequence from genomcis (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTCTCTCCTACCTCAGCCACGCCCTCTTGGCATGCATCCCACTTTCCAATGCCCATCCAGGTATGGGTGAGCAAATGCTGGAGATGCGCCGCGAAGCTAACAGGATCGAACGG
CGATCCTCAAAAGAACTCATCGGCGATCTGAAGACTCTCGCAGACTCAAAGCTGACGGCAATCGGAAAAGACATCAAGGCAATCCTCCTCGACCAGAAGAATGCCGAATCATCAACCATC
GACACCTCCATTCCTGTTGGTGGGATCGGCAGTGCAGCCTGCAAAGCTGACCTCTGCTGTCACTGGAAATGGCTCTCGTACGAAATGACTGCCAAGTTTAACGGTACATCTGGTCGCTGC
TCCAAGTTCGCCCGTCAAGCTGTTCGCCTAGGTTTCCACGATGCCGCTGTTTGGACAAAAGACAGCAGCTATGGTGGAGCGGATGGAAGTATTCTTCTCAGCGACGAGATGTCTCGCGCA
GATAACAACGGTCTCGCTGCTATTGCCGACCAGACGAACAAGTGGTACAAAAAGTACAATCAATACGGCTTGAGCATGGCCGATATCATTCAGTTTGGTGCCAATGTCGCTACCGTAGTA
TGCCCTCTTGGTCCTCGTGTCCGTTCCTTCGTTGGCCGCAAGGATAACTCCAAGGCCGGCCCTACCGGTCTTCTACCTGGGGAGAAAGACTCCGCAAGCGTTCTCCTCAAGCTCTTTCAA
GCCAAGACCATTGATCCTCATGATCTTGTCGCCCTTGTTGGTGCCCATACGACGTCACAGCAGCACTTTGTCAATACAGCCCGTGATGGTGACCCTCAGGATACAACACCCGGTGTCTGG
GACGTGGCTTTCTACCCGCAGACTATCAACAACCCGCCTCCAAGAGTCCTAAAGTTCCAGAGCGATATCAATCTGAGCAAGGACTCGAGAACAAGCAGCGCTTGGACAGAGTTCAGTGAC
CGGAATACCGGTCAGCAAAAATGGAATCAG
GTATGTGTCTGCCCTTTACACTTCTTTGCAATCACGTTGCTGATAAATTCAGGACTACGCTAAAGCGTATACCCGTCTCTCCCTCCTCGG
TGTGAATAACATCAATGACCTAAAGGAGTGCACACAAGTAATGCCAGTGCAGCGCAATTCGTTTACTAGCGAGGATCAAGTGGTGCTGGACAGGTGGCTGCAGGGCGAATTCGACCAGTT
GAACAACATGGTAGATGATGCGATCCAGCTAACTGGTGTAGTAACTGGACCTGGGAAGGAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTCTCTCCTACCTCAGCCACGCCCTCTTGGCATGCATCCCACTTTCCAATGCCCATCCAGGTATGGGTGAGCAAATGCTGGAGATGCGCCGCGAAGCTAACAGGATCGAACGG
CGATCCTCAAAAGAACTCATCGGCGATCTGAAGACTCTCGCAGACTCAAAGCTGACGGCAATCGGAAAAGACATCAAGGCAATCCTCCTCGACCAGAAGAATGCCGAATCATCAACCATC
GACACCTCCATTCCTGTTGGTGGGATCGGCAGTGCAGCCTGCAAAGCTGACCTCTGCTGTCACTGGAAATGGCTCTCGTACGAAATGACTGCCAAGTTTAACGGTACATCTGGTCGCTGC
TCCAAGTTCGCCCGTCAAGCTGTTCGCCTAGGTTTCCACGATGCCGCTGTTTGGACAAAAGACAGCAGCTATGGTGGAGCGGATGGAAGTATTCTTCTCAGCGACGAGATGTCTCGCGCA
GATAACAACGGTCTCGCTGCTATTGCCGACCAGACGAACAAGTGGTACAAAAAGTACAATCAATACGGCTTGAGCATGGCCGATATCATTCAGTTTGGTGCCAATGTCGCTACCGTAGTA
TGCCCTCTTGGTCCTCGTGTCCGTTCCTTCGTTGGCCGCAAGGATAACTCCAAGGCCGGCCCTACCGGTCTTCTACCTGGGGAGAAAGACTCCGCAAGCGTTCTCCTCAAGCTCTTTCAA
GCCAAGACCATTGATCCTCATGATCTTGTCGCCCTTGTTGGTGCCCATACGACGTCACAGCAGCACTTTGTCAATACAGCCCGTGATGGTGACCCTCAGGATACAACACCCGGTGTCTGG
GACGTGGCTTTCTACCCGCAGACTATCAACAACCCGCCTCCAAGAGTCCTAAAGTTCCAGAGCGATATCAATCTGAGCAAGGACTCGAGAACAAGCAGCGCTTGGACAGAGTTCAGTGAC
CGGAATACCGGTCAGCAAAAATGGAATCAG
GACTACGCTAAAGCGTATACCCGTCTCTCCCTCCTCGGTGTGAATAACATCAATGACCTAAAGGAGTGCACACAAGTAATGCCAGTGCAG
CGCAATTCGTTTACTAGCGAGGATCAAGTGGTGCTGGACAGGTGGCTGCAGGGCGAATTCGACCAGTTGAACAACATGGTAGATGATGCGATCCAGCTAACTGGTGTAGTAACTGGACCT
GGGAAGGAATAG

Retrieve as FASTA