Entry information : PangHalPrx04
Entry ID 12215
Creation 2013-05-30 (Christophe Dunand)
Last sequence changes 2013-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Christophe Dunand)
Peroxidase information: PangHalPrx04
Name PangHalPrx04
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Ascomycota Saccharomycetes Saccharomycetaceae Pichia
Organism Pichia angusta (Hansenula polymorpha)    [TaxId: 4905 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PangHalPrx04
start..stop
S start..stop
NcHalPrx01 261 5e-88 2..253 11..265
GzHalPrx02 207 4e-68 41..221 25..201
MgrHalPrx01 207 3e-67 38..253 42..253
PnoHalPrx04 154 3e-46 50..231 32..213
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2489911..2490271 361 N° 2 2489544..2489843 300 N° 3 2489382..2489482 101  
complement(join(2489382..2489482,2489544..2489843,2489911..2490271))


exon

Literature and cross-references PangHalPrx04
Protein ref. UniProtKB:   B2B666
DNA ref. GenBank:   CU640366.1 (2490271..2489382)
Protein sequence: PangHalPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   253
PWM (Da):   %s   28014.24  
PI (pH):   %s   6.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLAFKVITSFSSIFTATYSTIESLITSPNQDTNHQQDHAFQAPSATDKRSPCPMVNALANHAYLPRDGSNVSLLKLIQAAKEGVNLAPDATLIVGLKALQTSTTGSWLTFNLDDLNKHGVIEHDASLSRKDVFFGDNHSFSPETWETVFKHFRGLEKIPLQVAAAARKERVESARASNPEFSLTEDQNRFSILETSLYLMVFGEGTQGNARTDWVKVLFEEERLPFQEGFTRSPTMLTLGQILELHKKVEAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGCTCGCCTTCAAAGTCATCACATCCTTCTCCTCCATATTCACCGCAACCTACAGCACGATCGAGTCCCTCATAACTTCCCCCAACCAGGACACCAACCACCAACAGGACCATGCC
TTCCAAGCCCCTTCCGCCACCGATAAACGCAGCCCATGTCCGATGGTCAACGCTCTCGCAAACCACGCCTACCTTCCCCGAGATGGGTCCAACGTCTCCCTCCTCAAGCTCATCCAAGCC
GCCAAAGAGGGCGTCAACCTCGCCCCCGACGCAACCCTCATCGTCGGCCTCAAAGCCCTCCAAACCTCCACCACTGGCAGCTGGCTAACCTTCAACCTGGACGACCTGAACAAACACGGC
G
GTGAGCTCCCCCCCCTGCCACCCCATGAGTAAGCAACGCTGACACATGCCCCCCACCTCTCCCTCAGTCATCGAACACGACGCCTCCCTCAGCAGAAAAGACGTCTTTTTCGGCGACAA
CCACTCCTTTTCCCCCGAGACGTGGGAAACAGTATTTAAACACTTTCGAGGACTGGAGAAAATCCCCCTCCAAGTTGCCGCAGCGGCCAGAAAGGAAAGAGTGGAGAGCGCAAGGGCTTC
CAACCCGGAGTTTAGCCTGACCGAGGATCAGAACAGGTTCTCCATTTTGGAGACCAGTCTGTATCTCATGGTCTTTGGGGAGGGAACACAGGGGAATGCGCGGACTGATTGGGTCAAGGT
GCTGTTTG
GTATGTTCTTTTTTATCGTATCAGCAAAATGATGATTGGGCTTGCTGACTTGAAGTGACAGAAGAGGAGAGGCTGCCGTTTCAGGAGGGGTTTACGCGGTCGCCTACGATGC
TGACTCTTGGTCAGATTTTAGAGTTGCACAAGAAGGTGGAGGCCGTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGCTCGCCTTCAAAGTCATCACATCCTTCTCCTCCATATTCACCGCAACCTACAGCACGATCGAGTCCCTCATAACTTCCCCCAACCAGGACACCAACCACCAACAGGACCATGCC
TTCCAAGCCCCTTCCGCCACCGATAAACGCAGCCCATGTCCGATGGTCAACGCTCTCGCAAACCACGCCTACCTTCCCCGAGATGGGTCCAACGTCTCCCTCCTCAAGCTCATCCAAGCC
GCCAAAGAGGGCGTCAACCTCGCCCCCGACGCAACCCTCATCGTCGGCCTCAAAGCCCTCCAAACCTCCACCACTGGCAGCTGGCTAACCTTCAACCTGGACGACCTGAACAAACACGGC
G
TCATCGAACACGACGCCTCCCTCAGCAGAAAAGACGTCTTTTTCGGCGACAACCACTCCTTTTCCCCCGAGACGTGGGAAACAGTATTTAAACACTTTCGAGGACTGGAGAAAATCCCC
CTCCAAGTTGCCGCAGCGGCCAGAAAGGAAAGAGTGGAGAGCGCAAGGGCTTCCAACCCGGAGTTTAGCCTGACCGAGGATCAGAACAGGTTCTCCATTTTGGAGACCAGTCTGTATCTC
ATGGTCTTTGGGGAGGGAACACAGGGGAATGCGCGGACTGATTGGGTCAAGGTGCTGTTTG
AAGAGGAGAGGCTGCCGTTTCAGGAGGGGTTTACGCGGTCGCCTACGATGCTGACTCTT
GGTCAGATTTTAGAGTTGCACAAGAAGGTGGAGGCCGTTTAA

Retrieve as FASTA