Entry information : CberCP01
Entry ID 12216
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: CberCP01
Name CberCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Cucurbitariaceae Cucurbitaria
Organism Cucurbitaria berberidis    [TaxId: 45142 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CberCP01
start..stop
S start..stop
AalteCP01 1353 0 1..757 1..760
PterCP 1345 0 1..757 1..760
PtritCP01 1343 0 1..757 1..760
PnoCP01 1337 0 1..757 1..762
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1193518..1193777 260 N° 2 1193833..1194305 473 N° 3 1194358..1195898 1541  
join(1193518..1193777,1193833..1194305,1194358..1195898)


exon

Literature and cross-references CberCP01
DNA ref. JGI genome:   scaffold_2 (1193518..1195898)
Cluster/Prediction ref. JGI gene:   363396
Protein sequence: CberCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   758
PWM (Da):   %s   83907.15  
PI (pH):   %s   6.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKGECPMKDANVAGGGTRNQDWWPNELKINILRQHDPRQNPLGADFNYAEEFKKLDYEALKKDLTALMTDSQDWWPADFGHYGGLFIRMAWHSAGTYRVTDGRGGGGDGQQRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLMLLTGNVALESMGCETFGFAGGRADTFQSDESVYWGGETEWLGNEVRYARGHKGVGGEGVVDGDEHKVDHKDIHSRDLEKPLAAAHMGLIYVNPEGPDGVPDPLAAARDIRTTFSRMAMNDEETAALIIGGHSFGKTHGAAPSENTGPDPNSEDLATQGFGWVNKHGRGNGPDTITSGLEVTWTGTPTKWSNKYLEYLYKYEWELEKSPAGANQYVAKTTDEIIPDAYDQNKKHKPRMLTTDLSMRMDPGFEKITRRWLDHPEELHDAFSRAWFKLLHRDMGPRSRWLGPEIPKEVLIWEDPVPAVEGEVIGEADISSLKKAILSAGIEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGVKSKSSKKVSLADLIVLAGVAALEKAAGVSVPFTPGRTDATQEQTDAESFEHLEPVTDGFRNYGKGTDRVRTEQLDVDKAHLLRLTAPELVVLTGGMRALNANWDGSSHGVLTKRPGQLTNDFFVNLLDVNTEWKPASSGNPPELYEGSDRKSRQKKWTATRHDLIFGSHPELRSIAELYAQSDNTDKFVKDFVAAWDKIMNNDRFDVKTKSVSGKLSALTKPRL*

Retrieve as FASTA  
Remarks complete sequence from genomics
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAAAGGCGAGTGTCCCATGAAGGACGCCAATGTCGCCGGCGGCGGCACCAGGAACCAAGACTGGTGGCCAAATGAGCTCAAGATCAACATTCTCCGCCAGCACGACCCCCGGCAG
AATCCGCTGGGTGCCGACTTCAACTATGCCGAAGAGTTCAAGAAGCTGGACTACGAGGCGCTGAAGAAGGACCTCACGGCCCTGATGACAGACTCGCAGGATTGGTGGCCTGCGGATTTC
GGTCACTATGGTGGTCTCTT
GTGAGTGGAGCCTCTTCATCCCAGTGACAATTGGCAGGCTGACGTCTTTTGGTAGCATCCGAATGGCATGGCACTCTGCAGGAACCTACCGTGTCACGGA
CGGCCGTGGTGGCGGTGGTGATGGCCAGCAACGCTTTGCTCCCCTCAACGCCTGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTGCTCTGGCCCATCAAGCAAAAGTACGGCAA
CAAGATCTCCTGGGCCGATCTGATGCTCCTGACCGGCAACGTCGCTCTCGAGTCCATGGGCTGCGAGACGTTCGGTTTCGCAGGTGGCCGTGCCGACACCTTCCAGTCTGACGAGTCTGT
ATACTGGGGTGGCGAGACCGAGTGGCTAGGCAACGAGGTCCGCTACGCACGCGGCCACAAGGGTGTTGGGGGCGAGGGTGTCGTTGATGGCGACGAGCACAAGGTTGACCACAAGGACAT
CCACTCGCGAGACCTTGAGAAGCCATTGGCTGCCGCCCACATGGGTCTCATCTATGTCAACCCTGAAG
GTGAGTTTGTCTCGTTCACATCTGGAACCCCGCAGTGTCTGACTACTTCTAG

GTCCCGACGGTGTTCCGGACCCTCTTGCCGCCGCGCGAGACATCCGCACAACCTTTAGCCGTATGGCCATGAACGACGAGGAGACTGCCGCTCTTATCATCGGTGGCCATTCCTTCGGCA
AGACGCACGGTGCTGCTCCTTCAGAGAATACGGGACCCGACCCCAACAGCGAAGACCTCGCAACACAAGGCTTCGGCTGGGTCAACAAGCACGGTCGTGGCAATGGCCCAGATACCATCA
CTAGCGGTCTGGAGGTCACCTGGACCGGCACTCCCACCAAATGGAGCAACAAGTACCTCGAGTACCTGTACAAGTACGAGTGGGAACTTGAGAAGAGCCCGGCTGGTGCCAACCAGTATG
TCGCCAAGACCACTGACGAGATCATTCCCGACGCCTACGACCAGAACAAGAAGCACAAGCCAAGGATGTTGACCACTGATTTGTCCATGCGCATGGACCCTGGCTTCGAGAAGATCACTC
GTCGCTGGCTAGACCACCCAGAGGAGCTTCACGACGCGTTTAGCCGCGCCTGGTTCAAGCTGCTTCACCGTGACATGGGCCCGCGATCGAGGTGGCTCGGTCCTGAAATTCCCAAAGAGG
TCCTTATCTGGGAAGACCCTGTGCCTGCCGTCGAGGGTGAGGTCATTGGCGAAGCTGACATCTCCAGCCTGAAGAAGGCGATTCTCAGTGCTGGCATTGAGCCTGCGAAGCTCATCCGCA
CTGCATGGGCGTCAGCAGCTTCCTTCCGCGGTAGCGACAAGCGTGGCGGTGCCAACGGTGCCCGCATCCGTCTCGCTCCTCAAAAGGATTGGGAAGTCAACAACCCCAAGGAGCTCGCCG
AGGTCCTCAAGGCCCTCGAGGGTGTCAAGTCCAAGTCCAGCAAGAAGGTCTCGTTGGCTGATCTGATTGTCTTGGCTGGTGTCGCCGCGCTCGAGAAGGCTGCTGGTGTCTCCGTTCCGT
TCACACCTGGACGTACCGATGCCACACAGGAGCAGACCGACGCTGAGTCATTCGAGCACCTCGAGCCCGTCACCGACGGCTTCCGTAACTACGGCAAGGGCACCGACCGTGTCCGCACCG
AGCAGTTGGACGTGGACAAGGCTCACCTCCTCCGCCTCACTGCACCCGAGTTGGTCGTCCTTACCGGCGGTATGCGTGCCCTGAACGCCAACTGGGACGGTTCATCCCACGGCGTTTTGA
CCAAGCGCCCCGGCCAGCTCACCAACGACTTCTTCGTCAACCTGCTCGACGTCAACACGGAGTGGAAGCCTGCCAGCTCTGGCAACCCTCCTGAGCTGTACGAGGGCAGCGACCGCAAGT
CACGCCAGAAGAAGTGGACTGCCACACGCCACGACCTGATCTTTGGCTCGCATCCCGAGCTTCGGTCTATTGCTGAGCTCTACGCGCAGTCGGACAACACGGACAAGTTTGTCAAGGACT
TTGTGGCCGCTTGGGACAAGATCATGAATAACGACCGGTTCGATGTGAAAACCAAGTCGGTGAGTGGTAAATTGAGTGCGCTGACCAAGCCTCGTCTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAAAGGCGAGTGTCCCATGAAGGACGCCAATGTCGCCGGCGGCGGCACCAGGAACCAAGACTGGTGGCCAAATGAGCTCAAGATCAACATTCTCCGCCAGCACGACCCCCGGCAG
AATCCGCTGGGTGCCGACTTCAACTATGCCGAAGAGTTCAAGAAGCTGGACTACGAGGCGCTGAAGAAGGACCTCACGGCCCTGATGACAGACTCGCAGGATTGGTGGCCTGCGGATTTC
GGTCACTATGGTGGTCTCTT
CATCCGAATGGCATGGCACTCTGCAGGAACCTACCGTGTCACGGACGGCCGTGGTGGCGGTGGTGATGGCCAGCAACGCTTTGCTCCCCTCAACGCCTGG
CCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTGCTCTGGCCCATCAAGCAAAAGTACGGCAACAAGATCTCCTGGGCCGATCTGATGCTCCTGACCGGCAACGTCGCTCTCGAGTCC
ATGGGCTGCGAGACGTTCGGTTTCGCAGGTGGCCGTGCCGACACCTTCCAGTCTGACGAGTCTGTATACTGGGGTGGCGAGACCGAGTGGCTAGGCAACGAGGTCCGCTACGCACGCGGC
CACAAGGGTGTTGGGGGCGAGGGTGTCGTTGATGGCGACGAGCACAAGGTTGACCACAAGGACATCCACTCGCGAGACCTTGAGAAGCCATTGGCTGCCGCCCACATGGGTCTCATCTAT
GTCAACCCTGAAG
GTCCCGACGGTGTTCCGGACCCTCTTGCCGCCGCGCGAGACATCCGCACAACCTTTAGCCGTATGGCCATGAACGACGAGGAGACTGCCGCTCTTATCATCGGTGGC
CATTCCTTCGGCAAGACGCACGGTGCTGCTCCTTCAGAGAATACGGGACCCGACCCCAACAGCGAAGACCTCGCAACACAAGGCTTCGGCTGGGTCAACAAGCACGGTCGTGGCAATGGC
CCAGATACCATCACTAGCGGTCTGGAGGTCACCTGGACCGGCACTCCCACCAAATGGAGCAACAAGTACCTCGAGTACCTGTACAAGTACGAGTGGGAACTTGAGAAGAGCCCGGCTGGT
GCCAACCAGTATGTCGCCAAGACCACTGACGAGATCATTCCCGACGCCTACGACCAGAACAAGAAGCACAAGCCAAGGATGTTGACCACTGATTTGTCCATGCGCATGGACCCTGGCTTC
GAGAAGATCACTCGTCGCTGGCTAGACCACCCAGAGGAGCTTCACGACGCGTTTAGCCGCGCCTGGTTCAAGCTGCTTCACCGTGACATGGGCCCGCGATCGAGGTGGCTCGGTCCTGAA
ATTCCCAAAGAGGTCCTTATCTGGGAAGACCCTGTGCCTGCCGTCGAGGGTGAGGTCATTGGCGAAGCTGACATCTCCAGCCTGAAGAAGGCGATTCTCAGTGCTGGCATTGAGCCTGCG
AAGCTCATCCGCACTGCATGGGCGTCAGCAGCTTCCTTCCGCGGTAGCGACAAGCGTGGCGGTGCCAACGGTGCCCGCATCCGTCTCGCTCCTCAAAAGGATTGGGAAGTCAACAACCCC
AAGGAGCTCGCCGAGGTCCTCAAGGCCCTCGAGGGTGTCAAGTCCAAGTCCAGCAAGAAGGTCTCGTTGGCTGATCTGATTGTCTTGGCTGGTGTCGCCGCGCTCGAGAAGGCTGCTGGT
GTCTCCGTTCCGTTCACACCTGGACGTACCGATGCCACACAGGAGCAGACCGACGCTGAGTCATTCGAGCACCTCGAGCCCGTCACCGACGGCTTCCGTAACTACGGCAAGGGCACCGAC
CGTGTCCGCACCGAGCAGTTGGACGTGGACAAGGCTCACCTCCTCCGCCTCACTGCACCCGAGTTGGTCGTCCTTACCGGCGGTATGCGTGCCCTGAACGCCAACTGGGACGGTTCATCC
CACGGCGTTTTGACCAAGCGCCCCGGCCAGCTCACCAACGACTTCTTCGTCAACCTGCTCGACGTCAACACGGAGTGGAAGCCTGCCAGCTCTGGCAACCCTCCTGAGCTGTACGAGGGC
AGCGACCGCAAGTCACGCCAGAAGAAGTGGACTGCCACACGCCACGACCTGATCTTTGGCTCGCATCCCGAGCTTCGGTCTATTGCTGAGCTCTACGCGCAGTCGGACAACACGGACAAG
TTTGTCAAGGACTTTGTGGCCGCTTGGGACAAGATCATGAATAACGACCGGTTCGATGTGAAAACCAAGTCGGTGAGTGGTAAATTGAGTGCGCTGACCAAGCCTCGTCTTTAG

Retrieve as FASTA