Entry information : CberCIIAB01
Entry ID 12217
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: CberCIIAB01
Name CberCIIAB01
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Cucurbitariaceae Cucurbitaria
Organism Cucurbitaria berberidis    [TaxId: 45142 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CberCIIAB01
start..stop
S start..stop
AbraCIIAB01 459 2e-164 1..316 1..327
AalteCIIAB02 454 3e-162 1..316 1..327
Ssrc1lsm3aCIIAB01 434 3e-155 50..316 11..277
PnoCIIAB01 434 5e-155 51..316 37..302
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1039019..1039571 553 N° 2 1038566..1038963 398  
complement(join(1038566..1038963,1039019..1039571))


exon

Literature and cross-references CberCIIAB01
DNA ref. JGI genome:   scaffold_3 (1039571..1038566)
Cluster/Prediction ref. JGI gene:   285979
Protein sequence: CberCIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (297)
PWM (Da):   %s   32848.41 (30608.2)  
PI (pH):   %s   8.76 (8.21) Peptide Signal:   %s   cut: 20 range:20-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYIRSIFVTTLAATSTARALNLAEGANSAAGSSKRALGSVVNWTRGIFNRQTTCPAVWSEISTNLTAQFLADGQCTDAARAAIRSAFHDCFNGACDGSLILANECSNSENAGLSQLCGNLANIANQAKVGVADLIQFAAAHAIKTCPGGPTVPVKIGRKDSSTANALGVLPAHNSGGDDLVKLFASKGFTPTDLAALIGAHTTAKQRFADPSKAGASLDSTVGTWDTKFYSETKSGKAPFTLQADKNIAENSQTSAPFSNFASSKGAWDAAFVSAMTKMSMLGVDGSNLIDCTGALPGGSRKREIKNSNIFDRLKW*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTCGCTCCATCTTCGTCACCACCTTGGCGGCTACTAGCACAGCACGAGCGCTGAACCTAGCTGAAGGGGCAAACTCCGCAGCCGGCAGCTCAAAACGCGCACTCGGAAGCGTT
GTTAACTGGACTAGAGGCATTTTCAACAGACAAACAACATGTCCTGCTGTGTGGAGCGAGATCTCCACCAACCTCACAGCCCAATTTCTAGCAGACGGTCAATGTACGGATGCGGCACGC
GCAGCCATTCGATCAGCCTTCCACGACTGCTTCAATGGCGCCTGTGATGGATCCCTTATCCTTGCCAATGAGTGCTCAAACTCAGAGAACGCGGGTCTCTCTCAGCTATGCGGCAACCTT
GCGAACATTGCAAATCAGGCGAAAGTCGGTGTTGCAGATCTCATCCAGTTCGCTGCTGCACACGCGATCAAGACGTGTCCTGGTGGACCCACCGTTCCCGTCAAGATAGGCCGTAAGGAC
TCCAGCACTGCAAACGCCCTTGGTGTGCTTCCAGCTCACAATTCCGGTGGCGATGATCTGGTGAAACTTTTCG
GTACGTTGACTCTTCCACGAAATGGTTATCTTGGCTAATACTGTGAC
TGCTTCAGCGTCGAAGGGATTCACACCTACCGATCTCGCCGCCTTAATCGGTGCCCACACAACGGCTAAGCAGCGCTTCGCTGACCCATCCAAAGCTGGCGCATCTCTCGACTCTACCGT
CGGTACTTGGGACACCAAATTCTACTCAGAAACGAAGAGTGGCAAGGCACCTTTCACCCTACAAGCCGACAAGAACATTGCGGAGAACTCGCAAACATCCGCCCCTTTTAGCAACTTCGC
CTCGAGTAAGGGTGCTTGGGACGCGGCTTTTGTTAGTGCAATGACGAAAATGAGCATGTTGGGCGTTGATGGAAGTAATCTGATCGATTGTACGGGTGCGCTGCCCGGGGGGAGCAGGAA
GCGGGAAATCAAGAACAGCAATATCTTTGACCGCCTCAAATGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTCGCTCCATCTTCGTCACCACCTTGGCGGCTACTAGCACAGCACGAGCGCTGAACCTAGCTGAAGGGGCAAACTCCGCAGCCGGCAGCTCAAAACGCGCACTCGGAAGCGTT
GTTAACTGGACTAGAGGCATTTTCAACAGACAAACAACATGTCCTGCTGTGTGGAGCGAGATCTCCACCAACCTCACAGCCCAATTTCTAGCAGACGGTCAATGTACGGATGCGGCACGC
GCAGCCATTCGATCAGCCTTCCACGACTGCTTCAATGGCGCCTGTGATGGATCCCTTATCCTTGCCAATGAGTGCTCAAACTCAGAGAACGCGGGTCTCTCTCAGCTATGCGGCAACCTT
GCGAACATTGCAAATCAGGCGAAAGTCGGTGTTGCAGATCTCATCCAGTTCGCTGCTGCACACGCGATCAAGACGTGTCCTGGTGGACCCACCGTTCCCGTCAAGATAGGCCGTAAGGAC
TCCAGCACTGCAAACGCCCTTGGTGTGCTTCCAGCTCACAATTCCGGTGGCGATGATCTGGTGAAACTTTTCG
CGTCGAAGGGATTCACACCTACCGATCTCGCCGCCTTAATCGGTGCC
CACACAACGGCTAAGCAGCGCTTCGCTGACCCATCCAAAGCTGGCGCATCTCTCGACTCTACCGTCGGTACTTGGGACACCAAATTCTACTCAGAAACGAAGAGTGGCAAGGCACCTTTC
ACCCTACAAGCCGACAAGAACATTGCGGAGAACTCGCAAACATCCGCCCCTTTTAGCAACTTCGCCTCGAGTAAGGGTGCTTGGGACGCGGCTTTTGTTAGTGCAATGACGAAAATGAGC
ATGTTGGGCGTTGATGGAAGTAATCTGATCGATTGTACGGGTGCGCTGCCCGGGGGGAGCAGGAAGCGGGAAATCAAGAACAGCAATATCTTTGACCGCCTCAAATGGTAG

Retrieve as FASTA