Entry information : LuAPx06 (Lus10000180|PACid:23149030)
Entry ID 12219
Creation 2013-05-29 (Qiang LI)
Last sequence changes 2013-05-30 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2013-10-11 (Qiang Li)
Peroxidase information: LuAPx06 (Lus10000180|PACid:23149030)
Name (synonym) LuAPx06 (Lus10000180|PACid:23149030)
Class Ascorbate peroxidase     [Orthogroup: APx003]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuAPx06
start..stop
S start..stop
LuAPx231 572 0 1..293 4..296
EgrAPx09 387 1e-136 4..268 2..247
EglAPx09 385 3e-136 4..268 2..247
EguAPx09 385 5e-136 4..268 2..247
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2199549..2199667 119 N° 2 2199754..2199932 179 N° 3 2199984..2200033 50 N° 4 2200129..2200194 66
N° 5 2200292..2200426 135 N° 6 2200504..2200583 80 N° 7 2200664..2200916 253  
join(2199549..2199667,2199754..2199932,2199984..2200033,2200129..2200194,2200292 ..2200426,2200504..2200583,2200664..2200916)


exon

Literature and cross-references LuAPx06 (Lus10000180|PACid:23149030)
DNA ref. Phytozome 11:   scaffold272 (2199549..2200916)
Protein sequence: LuAPx06 (Lus10000180|PACid:23149030)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   293
PWM (Da):   %s   32773.92  
PI (pH):   %s   9.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
PAAATPVVDAEYLKEIDKARRQLRALIYGRQCAPIMLRLAFHDAGTYDARTRTGGPNGSIRHRNELSRVANSGINVAIDFCGQLLKKNPICLKLLTLLEQIKAMHPRITYADLYLAGVVAVEVTGGPSIDFVPGRKDSTESADEDGRLPNPNQGPSHLRDVFYRMGLSDRDIVVLSGAHTLGRAHQERSGFDGPWTKEPFKFDNSYFVELAKGETQGLVKMPTDKALMEDPRFREFVMLYAKDEDAFLEDYAMSHKKMSELGFSSAIWRKVRALLWLQHLKALVGYSRRTK

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCAGCAGCAGCAACACCGGTAGTGGATGCAGAGTACTTGAAGGAGATTGATAAGGCTCGCCGCCAACTTCGCGCTCTCATTTACGGCAGACAATGCGCTCCCATCATGCTTCGCTTAGCG
TAATCAATCAAAACCATCATTACTTCTTAATTAATGTCCACCCCTCTCTGGTTTCTTAAGCGTGTACTCTTTTAATTTGCTGAAGATTTCATGATGCGGGGACATATGATGCGAGAACGC
GGACCGGAGGGCCTAACGGTTCGATCCGGCACCGGAATGAGCTGTCTCGTGTTGCTAACTCTGGCATTAACGTCGCCATTGACTTCTGCGGTCAGCTTCTGAAAAAGAATCCCATCTGTC
TAAAGTTGCTAACTTTGTTGTTGG
GTAATAGTCATCATCATGATTCTGGAACTGGGTTTTGTTTCTTTTCTTCAGAACAAATCAAGGCTATGCATCCCAGGATCACCTATGCAGATTTGT
ACCAG
GCAAATTAAATCCTGCTTGGTGATAACATTGCATGCCTTTTTGTCCTAATGATTTACTAATTTGACATCTTTCTTCTTTATGTGGAGTTGTATAGCTTGCTGGAGTTGTTGCAGT
TGAGGTGACAGGAGGTCCATCAATTGACTTTGTCCCAGGCAGAAAG
GTTGACAGACACAAAAGAGAAATCTTGTGTTATGTTCTGTTGTGAGCTTCCTAGTAAATTTATGGCTTGAAACT
TTGCCTGCTTTTTTTTTCAACAGGATTCGACAGAGTCAGCTGATGAAGATGGGCGCCTACCTAATCCAAACCAAGGTCCTTCTCACCTCAGAGATGTCTTCTACAGAATGGGTCTTTCTG
ATAGGGATATTGTTGTACTTTCTGGCGCCCACACTCTG
GTAGTTTACTTGAAAACACATTTTAACAACTTCTTCTTCTGTTTCCCAAGTTTACACATTCAAACTTCTTTTACCAGGGAAG
AGCACATCAAGAAAGATCAGGTTTTGATGGTCCATGGACCAAGGAACCATTCAAGTTTGACAACTCTTACTTCGT
GTAAGCTTTCTCTATCTTTCAACTCTGCCAAATTCAGCAATGCTC
AATTCTCTAATATGGAATGTTCTATCTATGATTAGGGAGCTGGCTAAAGGGGAGACACAAGGACTGGTGAAGATGCCGACTGACAAGGCTCTAATGGAAGATCCCAGGTTCCGCGAATTC
GTCATGTTATACGCCAAGGATGAAGATGCATTCCTTGAAGACTATGCAATGTCACACAAGAAAATGTCTGAATTAGGCTTCTCCTCAGCAATCTGGCGCAAGGTTCGAGCTTTGCTGTGG
CTTCAGCATCTCAAAGCCTTGGTTGGATACAGCCGGCGAACCAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCAGCAGCAGCAACACCGGTAGTGGATGCAGAGTACTTGAAGGAGATTGATAAGGCTCGCCGCCAACTTCGCGCTCTCATTTACGGCAGACAATGCGCTCCCATCATGCTTCGCTTAGCA
TTTCATGATGCGGGGACATATGATGCGAGAACGCGGACCGGAGGGCCTAACGGTTCGATCCGGCACCGGAATGAGCTGTCTCGTGTTGCTAACTCTGGCATTAACGTCGCCATTGACTTC
TGCGGTCAGCTTCTGAAAAAGAATCCCATCTGTCTAAAGTTGCTAACTTTGTTGTTGG
AACAAATCAAGGCTATGCATCCCAGGATCACCTATGCAGATTTGTACCAGCTTGCTGGAGTT
GTTGCAGTTGAGGTGACAGGAGGTCCATCAATTGACTTTGTCCCAGGCAGAAAG
GATTCGACAGAGTCAGCTGATGAAGATGGGCGCCTACCTAATCCAAACCAAGGTCCTTCTCACCTC
AGAGATGTCTTCTACAGAATGGGTCTTTCTGATAGGGATATTGTTGTACTTTCTGGCGCCCACACTCTG
GGAAGAGCACATCAAGAAAGATCAGGTTTTGATGGTCCATGGACCAAGGAA
CCATTCAAGTTTGACAACTCTTACTTCGT
GGAGCTGGCTAAAGGGGAGACACAAGGACTGGTGAAGATGCCGACTGACAAGGCTCTAATGGAAGATCCCAGGTTCCGCGAATTCGTCATG
TTATACGCCAAGGATGAAGATGCATTCCTTGAAGACTATGCAATGTCACACAAGAAAATGTCTGAATTAGGCTTCTCCTCAGCAATCTGGCGCAAGGTTCGAGCTTTGCTGTGGCTTCAG
CATCTCAAAGCCTTGGTTGGATACAGCCGGCGAACCAAGTGA

Retrieve as FASTA