Entry information : LuRboh216
Entry ID 12225
Creation 2013-05-29 (Qiang LI)
Last sequence changes 2013-05-30 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang Li)
Peroxidase information: LuRboh216
Name LuRboh216
Class Respiratory burst oxidase homolog     [Orthogroup: Rboh001]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh216
start..stop
S start..stop
LuRboh96 1422 0 17..781 35..845
MtRboh06 880 0 24..781 66..815
CsRboh07 866 0 43..781 69..784
EgrRboh07 865 0 43..781 71..796
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1409242..1409536 295 N° 2 1409595..1409805 211 N° 3 1409906..1410068 163 N° 4 1410538..1410843 306
N° 5 1411248..1411634 387 N° 6 1411728..1411823 96 N° 7 1411916..1412134 219 N° 8 1412212..1412373 162
N° 9 1412450..1412587 138 N° 10 1413242..1413367 126 N° 11 1413462..1413570 109 N° 12 1413605..1413738 134
join(1409242..1409536,1409595..1409805,1409906..1410068,1410538..1410843,1411248 ..1411634,1411728..1411823,1411916..1412134,1412212..1412373,1412450..1412587,14 13242..1413367,1413462..1413570,1413605..1413738)


exon

Literature and cross-references LuRboh216
DNA ref. Phytozome 11:   scaffold9 (1409242..1413738)
Protein sequence: LuRboh216
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   781
PWM (Da):   %s   88705.89 Transmb domain:   %s   o243-262i326-345o380-402i423-445o
PI (pH):   %s   8.93
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
SSLSSSNSSSSSSSSSMQMQHHYCSHLLDNGPLEGGHPPPNAIRFVEIGWEEVENRFNRLVIVRGESQPSVKGADFGYCVGIKDDPFMFVAGSDMINLWLLQCPEFAGQLLRALRGRRSSSRRRRRIKTDEEDSNYGSGITIRELYSHWHRLTSPSFSFQSSSNLLFDICDRDMDGKINQADITQGILLSASTNRLCVTHEEAQEHAASIMEVLDSTRCGYIQEVSKSKAEIVFRAYWRRSWILLMWLIICFSLFTWKFIQYKHRMAFEVMGYCLSTAKGAAETLKFNMALILLPICRNTITWIRRSTRINSVIPFNDNINFHKIVGGGIVIGVILHGGTHLACDFPRISGSDKATFRQTIAADFAYHQPSYVEILATTEVATGIAMVLLMAVAFTLATSWPRRQSALLPKSVRQVTGYNTFWYSHHLLILVYALLIVHSMFLFLTNNLFEKTTWMYIVFPVILYGGERVWRAIRSDSYNVQVLEASMFHGKVLHLKLQKPQGFKYKSGMYMFIQCPQISKLQWHPFSLTSGPKDDHLSVHMRALGDWSYEVYGLFQEAILSGRKEFPKIYIDGGYGAPSQDHVKYDVVLMIGLGIGATPFISILKDIRSQQDGSEETRRGKGPLRAYFYWVTREQSSFDWFRDSLRNISTSNQNMVSVIEVNNFLTTAHEEGDARSALISAAQALYRAKTGLDMLSRYQEARTHFGRPNWFSIFSTLAIRHEHERIGKNINRKEPIAMFCVGAGVFYCGPPALGKELEELCTNFSTKTPTRFVFHKEHY

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. 5' end is missing. PS is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCGTCTTTGTCTTCTTCAAATTCTTCTTCCTCTTCCTCCTCTAGTTCAATGCAGATGCAGCATCACTATTGCAGTCACTTGCTGGATAATGGTCCTTTAGAAGGAGGACATCCACCTCCC
AATGCAATAAGGTTCGTAGAAATTGGTTGGGAGGAGGTGGAGAACCGGTTCAACCGGCTGGTTATCGTCAGGGGAGAGTCTCAACCATCAGTCAAAGGGGCAGATTTTGGCTACTGTGTA
GGTATAAAGGATGACCCTTTTATGTTCGTTGCAGGTTCTGACATGATCAATCTGT
GTTCTGTGGTTTTTTTGGGTGAAAGCTCTAGTTGTGATTTTTGGTTCTTATGCTGCAGGGCTGCT
ACAGTGTCCTGAATTTGCAGGTCAGCTTTTGAGGGCATTAAGAGGGAGAAGAAGCAGCAGCAGAAGAAGAAGAAGAATAAAAACAGATGAAGAAGATTCCAACTATGGTAGTGGAATCAC
AATAAGAGAACTTTATAGCCATTGGCATCGGCTGACTTCTCCTAGTTTCAGTTTCCAGTCAAGCTCCAACCTTTTATTTGACAT
GTAATGCTCAACTTACCCTTGAAGTTATGCTCATCA
TTTCTGGAGATTATAAACAGTTTGTAACTTAACTGAAGCTTACACATTGATGTTACATTCTCAGATGTGACAGAGATATGGATGGAAAGATTAATCAGGCGGACATTACGCAAGGAATAT
TGCTAAGTGCTTCAACGAATAGACTGTGTGTAACACATGAGGAAGCACAAGAACATGCTGCTTCAATCATGGAGGTTCTGGATTCAACAAGATGTGGCTACATTGAG
GTACACCAACATC
TGATAAAATCTTCCCTTCAAGTATTGTCATGAACCATTAAGTCCCAATAACTCGAGTTGTTGGGAGAGAGTTCATATATATTCATAACACGCCCTTTCAAACAAAAGCTCTTGAGATTTG
CACAACTTTAGTAAGCCATGTGCACGGATTGGCGCTAGCGGGATTCTATCACTGATCTATCGGTCTTTTAAGGCTCCAATACCATGCAATGAACCGTTTAGTTCCAATAACTCGAGTTAT
TAGGGAGGGCTCATATTGATTTTTATGTTATTCATTAGTAGTATAGTAGTATACAAATTGTAAAGAGTTTTAACATTATATCTGGATTTAATTTCAACCATATAGTTAGTTGAAACATTG
CAGCCTAATGAACTAGCTGCACTACTCAGAGCAACCTTGCCAGGAAGCAGCAACAGTGGAAAGCTTGCTGTCAATGGTGACAATGCAATAAGCCACCAAGAAGTGTCAAAATCCAAGGCG
GAAATCGTGTTTAGGGCTTACTGGAGGAGATCATGGATATTGCTGATGTGGTTGATCATCTGCTTCTCACTATTCACATGGAAGTTCATTCAGTACAAGCACAGAATGGCATTTGAAGTA
ATGGGGTATTGCCTTTCCACTGCTAAAGGTGCAGCTGAGACACTCAAATTCAACATGGCTTTGATCCTCCTCCCCATTTGTCGAAACACCATCACTTGGATTCGGAGAAGCACAAGGATC
AACTCTGTTATTCCATTCAATGACAACATCAACTTCCACAAG
GTAAGCATCCAAGGGCTCGTTTGGATGAGTTATTTTGCATGTGTGGTGGTACTTTGGAGCAAAATGATGCATTATTAT
TTGAGAATGTGAGATTTATGAGATGCAAAGGGGTTATGATGCAGGAATTATCTTGTTTAGCTAATGAGTCAATTCAATGTGGTATTTGCTAAACGTAAAGGCCAAAGTACTCGAAATACC
GGGGTATTTTAAATACCTCCACCCCCGACTATTTAAAATACTGCGGCCGCCATAGGTTTTTTTATTGGATGCTAAATGAATTATTTTGATCCAAATAACTCATCCAAACAACCTGTAAAG
GTGTCAAACCCGCGAGTTAGGTTTAGATTTAAGGTTCGTTACCCTGTGAGTGACTCAATAATAACTTGTTGGTGTGTGTTCATCAGATAGTTGGTGGAGGGATAGTGATTGGAGTAATAC
TACATGGTGGAACACATCTTGCTTGTGACTTCCCAAGAATAAGTGGTTCAGACAAGGCAACTTTCAGGCAAACCATAGCAGCCGACTTTGCTTATCACCAACCTTCATATGTTGAGATAT
TGGCCACCACAGAGGTTGCAACTGGGATTGCAATGGTATTGCTAATGGCGGTTGCATTCACTCTGGCGACAAGCTGGCCTCGTCGCCAATCAGCTTTGCTTCCAAAGTCTGTCAGACAAG
TAACTGGTTACAACACATTTTGGTACTCTCACCATTTGCTCATACTTGTCTATGCCCTCCTCATTGTTCACTCCATGTTCCTCTTCCTTACCAACAATCTCTTTGAGAAGACT
GTGAGTT
CTTTGTTTCTCTTTTCCTTCTTTGTGCCTTAATGTGTAAAGAGGGTAGTGTTAATAACCTGCAAAAAGGTTTGATCTTTGTTGCAGACATGGATGTACATTGTCTTCCCAGTGATTCTAT
ACGGTGGCGAACGCGTATGGAGAGCCATTAGATCAGATTCTTACAATGTACAAGTTCTGGAA
GTATGTACATAAATCTGAATGGTGGATGATAGCCTGTGAGATGAGATTCCCCAAAGGT
TTGGACTGATGTTTTTAATGCCTGTGGAATGCAGGCAAGCATGTTCCATGGAAAGGTTTTGCATCTGAAGCTGCAGAAACCTCAAGGTTTCAAGTACAAGAGTGGGATGTACATGTTCAT
ACAGTGTCCTCAGATTTCTAAGCTTCAGTGGCACCCATTTTCATTAACTTCAGGACCTAAAGATGATCACTTGAGTGTCCACATGAGAGCTCTTGGTGATTGGAGTTATGAAGTATATGG
TCTCTTCCAAGAG
GTGATAAATTGAACAAAGTTAACAAAACGGCAGAATTAAAACAGTAAGCTCAACCTGGTGTTTTTCTCCATTGTTAGGCAATATTATCTGGAAGGAAGGAGTTTCCA
AAGATATACATAGATGGAGGATATGGAGCTCCATCTCAAGACCATGTTAAGTATGATGTTGTCCTGATGATTGGTCTTGGCATTGGAGCTACACCCTTCATTAGTATCCTCAAAGACATA
AGATCTCAGCAG
GTAGACATAAGATTCTCAGCCTTTATCTTACTGTATAGATTTTGAGCTTTCTTGAACACTGAACCATGAAAGGCAGGATGGCAGTGAAGAAACCAGAAGGGGAAAGGG
TCCTTTAAGAGCCTACTTCTACTGGGTGACAAGGGAGCAAAGTTCGTTTGATTGGTTCAGAGACAGTTTGAGGAACATATCCACATCAAATCAAAACATGGTTAGT
GAACTGATTGCAAA
TTAAGAGCAACAATCCCACACGCCATTTCTACTCATAGCTAATGCTGTTGACGAACCCAAGCTGCTCGCAAGTGGTTCGTGTTCGGTTATTGAAAAGGTTCGATCAAAACTCTGCTCGAT
TTTAAACGAGTTGGCTTGTTAGCAAGCTCGGCTCGTCAGCTCGATGAGCTTGGCTCGCGAGCCAGTTCGTTTGAGGCTCGATTACTAACTCGACTAAGGCTAGAGAGTTGGCTCGAGTTT
GGCTCAATTGAGACTCGTTTGTTAGCTCAATTAGTGTAGCTAGTGAGTTGGTTTTAGAGCTTTTAATGGTTCGAATTTGTGATTTTATCTAAAAAACAAAAATATGATTATCAATAATGT
TGTCTTAATGACTAGTCATTTAATTAGACTTTGAGAGTACACTATTTTAGAATAGTTTAAATTTTGTATAAACTTATCCAAGTTGAGCTTGAAATTTAACTCGGTTTGTAAAAACTTGCA
AACAAGCCGAGTTGAACTCGTTAAGGCCTCTAGACGAGCCGAGCTTGGACTAATAATTAGTTTTTCGAGCCGGGCAAAGCTCGCTCGGCTCGTCAGAAGCCAGCCCTACTCATAGCTGAT
AGATAACAAACTGAGTTTCCTAAACATGCAGCAGAAGGCTGTGATTGAGGTGAACAACTTCTTGACAACAGCACATGAAGAAGGAGATGCAAGGTCAGCTCTGATCTCTGCAGCACAAGC
ACTGTATCGTGCCAAGACCGGCCTCGACATGTTGTCCCGGTATCAG
GTAAAACACTAGCTAGTGAGAGTTCAGATTGGTTCTTATATTATTCATTAACATCGAGACCTGACAGTCTTGAA
CCCGAAATGGGGAGTTTCAGGAGGCTAGGACGCATTTTGGTCGACCTAACTGGTTCAGCATCTTCTCAACGCTGGCTATAAGACATGAACACGAGAGGATTGGTAAGAACATTAACAGAA
AGGAACCAA
GTTTCAATGCAGTGCACCGACTGTTCTTCATATATTGCCATGTTTTGCGTGGGTGCAGGAGTGTTCTACTGTGGACCGCCAGCGCTAGGAAAAGAATTAGAGGAGCTATGT
ACCAATTTCTCAACCAAAACACCCACTCGATTTGTTTTCCACAAGGAACATTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCGTCTTTGTCTTCTTCAAATTCTTCTTCCTCTTCCTCCTCTAGTTCAATGCAGATGCAGCATCACTATTGCAGTCACTTGCTGGATAATGGTCCTTTAGAAGGAGGACATCCACCTCCC
AATGCAATAAGGTTCGTAGAAATTGGTTGGGAGGAGGTGGAGAACCGGTTCAACCGGCTGGTTATCGTCAGGGGAGAGTCTCAACCATCAGTCAAAGGGGCAGATTTTGGCTACTGTGTA
GGTATAAAGGATGACCCTTTTATGTTCGTTGCAGGTTCTGACATGATCAATCTGT
GGCTGCTACAGTGTCCTGAATTTGCAGGTCAGCTTTTGAGGGCATTAAGAGGGAGAAGAAGCAGC
AGCAGAAGAAGAAGAAGAATAAAAACAGATGAAGAAGATTCCAACTATGGTAGTGGAATCACAATAAGAGAACTTTATAGCCATTGGCATCGGCTGACTTCTCCTAGTTTCAGTTTCCAG
TCAAGCTCCAACCTTTTATTTGACAT
ATGTGACAGAGATATGGATGGAAAGATTAATCAGGCGGACATTACGCAAGGAATATTGCTAAGTGCTTCAACGAATAGACTGTGTGTAACACAT
GAGGAAGCACAAGAACATGCTGCTTCAATCATGGAGGTTCTGGATTCAACAAGATGTGGCTACATTGAG
CAAGAAGTGTCAAAATCCAAGGCGGAAATCGTGTTTAGGGCTTACTGGAGG
AGATCATGGATATTGCTGATGTGGTTGATCATCTGCTTCTCACTATTCACATGGAAGTTCATTCAGTACAAGCACAGAATGGCATTTGAAGTAATGGGGTATTGCCTTTCCACTGCTAAA
GGTGCAGCTGAGACACTCAAATTCAACATGGCTTTGATCCTCCTCCCCATTTGTCGAAACACCATCACTTGGATTCGGAGAAGCACAAGGATCAACTCTGTTATTCCATTCAATGACAAC
ATCAACTTCCACAAG
ATAGTTGGTGGAGGGATAGTGATTGGAGTAATACTACATGGTGGAACACATCTTGCTTGTGACTTCCCAAGAATAAGTGGTTCAGACAAGGCAACTTTCAGGCAA
ACCATAGCAGCCGACTTTGCTTATCACCAACCTTCATATGTTGAGATATTGGCCACCACAGAGGTTGCAACTGGGATTGCAATGGTATTGCTAATGGCGGTTGCATTCACTCTGGCGACA
AGCTGGCCTCGTCGCCAATCAGCTTTGCTTCCAAAGTCTGTCAGACAAGTAACTGGTTACAACACATTTTGGTACTCTCACCATTTGCTCATACTTGTCTATGCCCTCCTCATTGTTCAC
TCCATGTTCCTCTTCCTTACCAACAATCTCTTTGAGAAGACT
ACATGGATGTACATTGTCTTCCCAGTGATTCTATACGGTGGCGAACGCGTATGGAGAGCCATTAGATCAGATTCTTAC
AATGTACAAGTTCTGGAA
GCAAGCATGTTCCATGGAAAGGTTTTGCATCTGAAGCTGCAGAAACCTCAAGGTTTCAAGTACAAGAGTGGGATGTACATGTTCATACAGTGTCCTCAGATT
TCTAAGCTTCAGTGGCACCCATTTTCATTAACTTCAGGACCTAAAGATGATCACTTGAGTGTCCACATGAGAGCTCTTGGTGATTGGAGTTATGAAGTATATGGTCTCTTCCAAGAG
GCA
ATATTATCTGGAAGGAAGGAGTTTCCAAAGATATACATAGATGGAGGATATGGAGCTCCATCTCAAGACCATGTTAAGTATGATGTTGTCCTGATGATTGGTCTTGGCATTGGAGCTACA
CCCTTCATTAGTATCCTCAAAGACATAAGATCTCAGCAG
GATGGCAGTGAAGAAACCAGAAGGGGAAAGGGTCCTTTAAGAGCCTACTTCTACTGGGTGACAAGGGAGCAAAGTTCGTTT
GATTGGTTCAGAGACAGTTTGAGGAACATATCCACATCAAATCAAAACATGGTTAGT
GTGATTGAGGTGAACAACTTCTTGACAACAGCACATGAAGAAGGAGATGCAAGGTCAGCTCTG
ATCTCTGCAGCACAAGCACTGTATCGTGCCAAGACCGGCCTCGACATGTTGTCCCGGTATCAG
GAGGCTAGGACGCATTTTGGTCGACCTAACTGGTTCAGCATCTTCTCAACGCTGGCT
ATAAGACATGAACACGAGAGGATTGGTAAGAACATTAACAGAAAGGAACCAA
TTGCCATGTTTTGCGTGGGTGCAGGAGTGTTCTACTGTGGACCGCCAGCGCTAGGAAAAGAATTAGAG
GAGCTATGTACCAATTTCTCAACCAAAACACCCACTCGATTTGTTTTCCACAAGGAACATTACTAG

Retrieve as FASTA