Entry information : LfluCIIAA03
Entry ID 12229
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: LfluCIIAA03
Name LfluCIIAA03
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Lentitheciaceae Lentithecium
Organism Lentithecium fluviatile    [TaxId: 690899 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LfluCIIAA03
start..stop
S start..stop
GsteCIIAA01 507 0 1..378 1..377
DexiCIIAA01 469 5e-166 7..375 8..407
BdotCIIAA02 447 9e-158 1..378 1..371
ApulCIIAA01 441 2e-155 19..371 21..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1358886..1359492 607 N° 2 1358295..1358824 530  
complement(join(1358295..1358824,1358886..1359492))


exon

Literature and cross-references LfluCIIAA03
DNA ref. JGI genome:   scaffold_7 (1359492..1358295)
Cluster/Prediction ref. JGI gene:   441248
Protein sequence: LfluCIIAA03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   379 (357)
PWM (Da):   %s   40269.65 (37875.4)  
PI (pH):   %s   7.82 (8.11) Peptide Signal:   %s   cut: 22 range:22-378
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPTNFIIGLTVFSFIEGISAYPKMANTLREVEQIAKTKRQDDGSVAPVLIGDIKDGGKTAIGQAIARILLETDSGQSSEAGYKPPGALSSKQCAADTCCVWYYVSQVLTTTFTGPSGRCNALARAAIRLGFHDAGTWSQPLADSGKDFGGADGSIILSKSELSRSENNGLQIIAALIAGLQLKFGVGMGDLIQFAAKHAVVTCPLGPRIRTFVGRKDNSKAAPDGLLPGVNDSADKLISLFQDKTITPHDLVALLGAHTTSQQFFVDKTKLGAPQDGTPGVWDTLFYNQTLGKGPLPKQVFRFPSDIVLSKDSRTASEWASFSAAGGQSHWNEDYSYSYIRLSLLGVNNINNLTECTKVLPSAKPTFQGAGELLTDQ*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCTACCAACTTCATCATAGGCCTTACCGTCTTCTCTTTTATCGAAGGCATCTCCGCCTACCCAAAAATGGCCAACACCCTCCGCGAAGTCGAACAAATAGCAAAGACAAAACGT
CAAGACGACGGCTCTGTCGCCCCAGTCCTCATCGGCGACATAAAAGACGGCGGCAAAACAGCAATCGGGCAAGCCATTGCCAGAATCCTCCTCGAAACCGACTCAGGCCAGAGCTCCGAA
GCAGGATACAAGCCCCCAGGCGCACTGAGTTCGAAGCAATGCGCGGCGGATACTTGCTGTGTGTGGTACTACGTCTCCCAAGTTCTTACTACGACGTTCACCGGGCCTTCGGGTCGATGC
AATGCTCTCGCGCGCGCGGCTATCAGACTGGGTTTCCACGATGCAGGTACATGGTCCCAACCACTGGCCGATAGTGGCAAGGACTTTGGCGGCGCAGACGGAAGCATCATCCTCTCAAAA
TCGGAGCTCAGCAGGTCGGAAAACAACGGCTTGCAAATAATCGCCGCCCTCATTGCAGGCTTACAACTCAAATTCGGAGTCGGCATGGGCGATCTCATTCAATTCGCAGCCAAGCACGCT
GTCGTCA
GTACGTTCTTCCCCATCCAGTCCCATACCCATCAAATAGGTCGGTTTCTAACAAAGTGCAGCATGCCCCCTCGGCCCCCGCATCCGCACCTTCGTCGGCCGCAAAGACAACAG
CAAAGCCGCCCCAGACGGCCTCCTCCCCGGCGTCAACGACTCCGCCGACAAGCTAATCTCCCTCTTCCAAGACAAAACCATTACGCCACACGACCTCGTCGCGCTCCTCGGCGCGCACAC
CACCTCGCAGCAATTCTTCGTCGACAAAACCAAACTGGGTGCCCCGCAAGACGGCACCCCAGGCGTGTGGGACACGCTGTTCTACAACCAGACGCTCGGTAAGGGTCCGTTACCCAAGCA
GGTCTTCCGCTTCCCCAGCGATATTGTGCTGAGTAAGGATTCACGGACGGCGAGTGAGTGGGCGAGTTTTTCGGCGGCGGGTGGGCAGAGCCATTGGAATGAAGATTATTCGTATTCGTA
TATTCGGCTCTCTCTACTTGGTGTCAACAACATCAACAATCTGACGGAGTGCACGAAGGTGCTTCCGAGTGCGAAACCAACATTTCAGGGGGCGGGGGAGTTGCTTACGGATCAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCTACCAACTTCATCATAGGCCTTACCGTCTTCTCTTTTATCGAAGGCATCTCCGCCTACCCAAAAATGGCCAACACCCTCCGCGAAGTCGAACAAATAGCAAAGACAAAACGT
CAAGACGACGGCTCTGTCGCCCCAGTCCTCATCGGCGACATAAAAGACGGCGGCAAAACAGCAATCGGGCAAGCCATTGCCAGAATCCTCCTCGAAACCGACTCAGGCCAGAGCTCCGAA
GCAGGATACAAGCCCCCAGGCGCACTGAGTTCGAAGCAATGCGCGGCGGATACTTGCTGTGTGTGGTACTACGTCTCCCAAGTTCTTACTACGACGTTCACCGGGCCTTCGGGTCGATGC
AATGCTCTCGCGCGCGCGGCTATCAGACTGGGTTTCCACGATGCAGGTACATGGTCCCAACCACTGGCCGATAGTGGCAAGGACTTTGGCGGCGCAGACGGAAGCATCATCCTCTCAAAA
TCGGAGCTCAGCAGGTCGGAAAACAACGGCTTGCAAATAATCGCCGCCCTCATTGCAGGCTTACAACTCAAATTCGGAGTCGGCATGGGCGATCTCATTCAATTCGCAGCCAAGCACGCT
GTCGTCA
CATGCCCCCTCGGCCCCCGCATCCGCACCTTCGTCGGCCGCAAAGACAACAGCAAAGCCGCCCCAGACGGCCTCCTCCCCGGCGTCAACGACTCCGCCGACAAGCTAATCTCC
CTCTTCCAAGACAAAACCATTACGCCACACGACCTCGTCGCGCTCCTCGGCGCGCACACCACCTCGCAGCAATTCTTCGTCGACAAAACCAAACTGGGTGCCCCGCAAGACGGCACCCCA
GGCGTGTGGGACACGCTGTTCTACAACCAGACGCTCGGTAAGGGTCCGTTACCCAAGCAGGTCTTCCGCTTCCCCAGCGATATTGTGCTGAGTAAGGATTCACGGACGGCGAGTGAGTGG
GCGAGTTTTTCGGCGGCGGGTGGGCAGAGCCATTGGAATGAAGATTATTCGTATTCGTATATTCGGCTCTCTCTACTTGGTGTCAACAACATCAACAATCTGACGGAGTGCACGAAGGTG
CTTCCGAGTGCGAAACCAACATTTCAGGGGGCGGGGGAGTTGCTTACGGATCAGTAG

Retrieve as FASTA