Entry information : LfluCIIAB01
Entry ID 12241
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: LfluCIIAB01
Name LfluCIIAB01
Class Asco Class II type B     [Orthogroup: CIIAB001]*
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Lentitheciaceae Lentithecium
Organism Lentithecium fluviatile    [TaxId: 690899 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LfluCIIAB01
start..stop
S start..stop
Ssrc1lsm3aCIIAB06 303 7e-104 19..280 28..289
BdotCIIAB03 289 5e-98 19..277 53..312
DexiCIIAB01 278 6e-94 19..282 29..295
ClunCIIAB02 275 1e-92 19..280 30..292
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 129294..129938 645 N° 2 130043..130252 210  
join(129294..129938,130043..130252)


exon

Literature and cross-references LfluCIIAB01
DNA ref. JGI genome:   scaffold_29 (129294..130252)
Cluster/Prediction ref. JGI gene:   312173
Protein sequence: LfluCIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   284 (267)
PWM (Da):   %s   29825.63 (27763.5)  
PI (pH):   %s   4.35 (4.26) Peptide Signal:   %s   cut: 18 range:18-284
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLFRSTLLLGLSRWVMGQCPAVWSDVASTLQTAFAGCNDDARAALRAPFHDCVNGACDGSLVLGGECTRSENAGLEPYCDKISTWATQFDVGTADTIQFAQAVALAVCPGGPRIRALVGRQDSSTPAPEGIVPDPSDSVASILATFAAVGLSTTDVVALVGAHSTAKQFFDDPSQAGASLDSTPDAWDINFYGQTLAGTAPYTLESDKKMSTDLTTAVQWLDFSLNQAGWAAAFTSAMDKFTVTGNDVSILADCSSVLPGAAKIRREAMKAPIGERVFSRRIET*

Retrieve as FASTA  
Remarks incorrect sequence from genomics (1 intron). 5' added but doesn't seem right.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTATTTCGATCAACACTGTTGCTCGGCCTCTCCAGGTGGGTGATGGGTCAGTGTCCTGCGGTCTGGAGCGATGTGGCATCGACACTTCAAACAGCCTTTGCTGGGTGCAACGACGAC
GCCCGCGCAGCTCTCCGAGCGCCATTCCATGATTGCGTTAACGGAGCATGCGATGGAAGTCTTGTCCTGGGAGGCGAGTGCACACGATCGGAAAACGCAGGTTTAGAGCCCTACTGTGAC
AAGATCAGTACTTGGGCTACGCAGTTCGATGTTGGTACGGCTGACACCATTCAATTCGCGCAAGCCGTCGCTCTCGCTGTTTGCCCAGGAGGGCCACGGATTCGCGCCTTGGTGGGTCGA
CAGGACAGCTCAACGCCAGCACCGGAAGGCATCGTCCCGGATCCCAGTGACTCGGTGGCATCGATCCTAGCCACATTTGCAGCGGTAGGCCTCTCGACGACTGATGTTGTCGCCCTTGTT
GGCGCACACTCGACTGCGAAACAGTTCTTCGATGACCCGTCTCAAGCTGGTGCTTCTCTCGACTCGACACCTGATGCTTGGGATATTAACTTCTATGGCCAGACCTTGGCTGGAACGGCG
CCTTATACACTGGAAAGTGATAAGAAGATGTCGACTGACTTGACC
GTGAGTTATGTGTCCATTTTAAGGGTCGTTACTTGAGACTTCGTATTCCTGATCGCACAGTTCTGCTTCTTTGAT
GTGATGACAATGCTAACACGCTTTGATAGACGGCAGTGCAGTGGCTCGACTTCTCCTTGAATCAGGCTGGCTGGGCGGCAGCATTCACAAGCGCCATGGACAAGTTCACAGTCACTGGAA
ACGATGTTAGTATCCTCGCGGATTGTTCCTCTGTTCTGCCTGGCGCGGCCAAGATTAGGCGCGAAGCAATGAAGGCGCCAATTGGAGAGCGAGTTTTCAGTCGAAGGATCGAGACCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTATTTCGATCAACACTGTTGCTCGGCCTCTCCAGGTGGGTGATGGGTCAGTGTCCTGCGGTCTGGAGCGATGTGGCATCGACACTTCAAACAGCCTTTGCTGGGTGCAACGACGAC
GCCCGCGCAGCTCTCCGAGCGCCATTCCATGATTGCGTTAACGGAGCATGCGATGGAAGTCTTGTCCTGGGAGGCGAGTGCACACGATCGGAAAACGCAGGTTTAGAGCCCTACTGTGAC
AAGATCAGTACTTGGGCTACGCAGTTCGATGTTGGTACGGCTGACACCATTCAATTCGCGCAAGCCGTCGCTCTCGCTGTTTGCCCAGGAGGGCCACGGATTCGCGCCTTGGTGGGTCGA
CAGGACAGCTCAACGCCAGCACCGGAAGGCATCGTCCCGGATCCCAGTGACTCGGTGGCATCGATCCTAGCCACATTTGCAGCGGTAGGCCTCTCGACGACTGATGTTGTCGCCCTTGTT
GGCGCACACTCGACTGCGAAACAGTTCTTCGATGACCCGTCTCAAGCTGGTGCTTCTCTCGACTCGACACCTGATGCTTGGGATATTAACTTCTATGGCCAGACCTTGGCTGGAACGGCG
CCTTATACACTGGAAAGTGATAAGAAGATGTCGACTGACTTGACC
ACGGCAGTGCAGTGGCTCGACTTCTCCTTGAATCAGGCTGGCTGGGCGGCAGCATTCACAAGCGCCATGGACAAG
TTCACAGTCACTGGAAACGATGTTAGTATCCTCGCGGATTGTTCCTCTGTTCTGCCTGGCGCGGCCAAGATTAGGCGCGAAGCAATGAAGGCGCCAATTGGAGAGCGAGTTTTCAGTCGA
AGGATCGAGACCTGA

Retrieve as FASTA