Entry information : LfluCIIAA04
Entry ID 12242
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: LfluCIIAA04
Name LfluCIIAA04
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Lentitheciaceae Lentithecium
Organism Lentithecium fluviatile    [TaxId: 690899 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LfluCIIAA04
start..stop
S start..stop
CberCIIAA01 617 0 1..399 1..403
LmaCIIAA01 614 0 1..394 1..398
COsaCIIAA05 608 0 1..394 1..398
CheCIIAA05_C5 608 0 1..394 1..398
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45252..46229 978 N° 2 44966..45196 231  
complement(join(44966..45196,45252..46229))


exon

Literature and cross-references LfluCIIAA04
DNA ref. JGI genome:   scaffold_13 (46229..44966)
Cluster/Prediction ref. JGI gene:   338275
Protein sequence: LfluCIIAA04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   403 (382)
PWM (Da):   %s   43487.16 (41229.9)  
PI (pH):   %s   7.09 (7.09) Peptide Signal:   %s   cut: 21 range:21-402
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPLTILSYVLLSSLPTSLAHPGMGETMNQVKRAALASRAEAKQLIGDLKTLKDAQLTSIGKDIKAILLGTKGAESNTIDTSIPPGTVDSAACKADLCCVWKWISYEMTAKFNGTSGRCTKFARGAVRLGFHDAAVWTNTSTSGGADGSILLTNEIDRVDNDGLEAVADVFKAWYNKYNKYGVSMADLIQFGANVATVVCPLGPRIRSFVGRKDNAKAGPTGLLPGVDDSADKLIKLFQLKTIDAHDLVALVGAHTTSQQHFVDTTRDGDPQDSTPGIWDVAFYGQTTGSPPPRVLKFASDIVLSKDSRTKGEWQQFIGGQAHWNEDYAKAYTRLSLLGVNNINDLQECTKVLPPARTSFTSQDQVVLDMWLQGQFDQLNNLVDDAIMLSGVITNPGKKREE*

Retrieve as FASTA  
Remarks compelte sequence from genomics (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCCCTCACCATTCTCAGCTATGTCCTTCTGTCGTCTCTCCCAACCTCCCTCGCCCACCCAGGCATGGGAGAGACAATGAACCAAGTGAAGCGCGCCGCTTTAGCCTCCCGCGCT
GAAGCCAAGCAACTCATTGGAGACCTGAAGACACTGAAAGACGCCCAACTCACCAGCATCGGCAAGGACATCAAGGCTATTTTGCTCGGAACAAAAGGCGCGGAGTCGAACACGATCGAC
ACTTCAATTCCTCCTGGCACTGTCGACAGCGCAGCCTGTAAGGCCGACCTCTGCTGCGTATGGAAATGGATCTCATACGAGATGACGGCAAAGTTCAACGGCACTTCCGGCCGCTGCACA
AAGTTTGCGAGAGGCGCGGTGCGGTTGGGTTTCCATGATGCGGCCGTCTGGACCAACACAAGTACTTCTGGTGGTGCTGACGGCAGCATCTTGCTCACGAATGAGATTGATCGCGTGGAT
AACGATGGGCTGGAGGCAGTGGCTGATGTGTTCAAGGCCTGGTACAACAAGTACAATAAGTACGGTGTTTCGATGGCAGATCTCATCCAATTCGGCGCCAATGTGGCCACCGTCGTATGC
CCTCTCGGGCCGCGCATTCGTTCCTTTGTGGGGCGCAAGGACAATGCGAAGGCTGGGCCCACTGGTCTCTTGCCTGGTGTTGACGACTCGGCCGATAAGCTCATCAAGCTGTTCCAGCTC
AAGACCATTGATGCCCATGATCTTGTGGCGTTGGTGGGTGCGCACACGACTAGTCAGCAGCACTTCGTCGATACCACTCGGGATGGAGACCCACAGGATTCTACGCCTGGTATCTGGGAT
GTCGCATTTTATGGACAGACCACGGGAAGCCCGCCACCCAGGGTGCTCAAGTTTGCGTCAGACATTGTGCTGAGCAAGGATTCGAGGACAAAAGGAGAGTGGCAACAGTTTATCGGTGGA
CAGGCCCATTGGAACGAG
GTGAGTTGAATTGCTCGTCTATCCAACAAAAAGACTCTAGGGCTAATCTGTGCAGGACTACGCGAAAGCCTATACCCGTCTCTCCCTTCTTGGCGTCAACAA
CATCAACGACCTCCAGGAGTGCACCAAGGTGCTTCCGCCCGCGAGGACTTCATTCACCAGCCAGGATCAAGTTGTGCTCGATATGTGGTTGCAGGGCCAATTCGATCAACTGAACAACTT
AGTCGACGATGCGATTATGTTGAGCGGTGTTATCACGAATCCGGGCAAGAAGCGAGAGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCCCTCACCATTCTCAGCTATGTCCTTCTGTCGTCTCTCCCAACCTCCCTCGCCCACCCAGGCATGGGAGAGACAATGAACCAAGTGAAGCGCGCCGCTTTAGCCTCCCGCGCT
GAAGCCAAGCAACTCATTGGAGACCTGAAGACACTGAAAGACGCCCAACTCACCAGCATCGGCAAGGACATCAAGGCTATTTTGCTCGGAACAAAAGGCGCGGAGTCGAACACGATCGAC
ACTTCAATTCCTCCTGGCACTGTCGACAGCGCAGCCTGTAAGGCCGACCTCTGCTGCGTATGGAAATGGATCTCATACGAGATGACGGCAAAGTTCAACGGCACTTCCGGCCGCTGCACA
AAGTTTGCGAGAGGCGCGGTGCGGTTGGGTTTCCATGATGCGGCCGTCTGGACCAACACAAGTACTTCTGGTGGTGCTGACGGCAGCATCTTGCTCACGAATGAGATTGATCGCGTGGAT
AACGATGGGCTGGAGGCAGTGGCTGATGTGTTCAAGGCCTGGTACAACAAGTACAATAAGTACGGTGTTTCGATGGCAGATCTCATCCAATTCGGCGCCAATGTGGCCACCGTCGTATGC
CCTCTCGGGCCGCGCATTCGTTCCTTTGTGGGGCGCAAGGACAATGCGAAGGCTGGGCCCACTGGTCTCTTGCCTGGTGTTGACGACTCGGCCGATAAGCTCATCAAGCTGTTCCAGCTC
AAGACCATTGATGCCCATGATCTTGTGGCGTTGGTGGGTGCGCACACGACTAGTCAGCAGCACTTCGTCGATACCACTCGGGATGGAGACCCACAGGATTCTACGCCTGGTATCTGGGAT
GTCGCATTTTATGGACAGACCACGGGAAGCCCGCCACCCAGGGTGCTCAAGTTTGCGTCAGACATTGTGCTGAGCAAGGATTCGAGGACAAAAGGAGAGTGGCAACAGTTTATCGGTGGA
CAGGCCCATTGGAACGAG
GACTACGCGAAAGCCTATACCCGTCTCTCCCTTCTTGGCGTCAACAACATCAACGACCTCCAGGAGTGCACCAAGGTGCTTCCGCCCGCGAGGACTTCATTC
ACCAGCCAGGATCAAGTTGTGCTCGATATGTGGTTGCAGGGCCAATTCGATCAACTGAACAACTTAGTCGACGATGCGATTATGTTGAGCGGTGTTATCACGAATCCGGGCAAGAAGCGA
GAGGAGTAA

Retrieve as FASTA