Entry information : LfluCIIAB02
Entry ID 12243
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: LfluCIIAB02
Name LfluCIIAB02
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Lentitheciaceae Lentithecium
Organism Lentithecium fluviatile    [TaxId: 690899 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LfluCIIAB02
start..stop
S start..stop
CberCIIAB01 443 3e-158 1..315 1..316
AbraCIIAB01 427 7e-152 1..315 1..327
AalteCIIAB02 426 2e-151 1..315 1..327
PnoCIIAB01 416 1e-147 46..315 32..302
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1250112..1250529 418 N° 2 1249529..1250058 530  
complement(join(1249529..1250058,1250112..1250529))


exon

Literature and cross-references LfluCIIAB02
DNA ref. JGI genome:   scaffold_5 (1250529..1249529)
Cluster/Prediction ref. JGI gene:   484681
Protein sequence: LfluCIIAB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (296)
PWM (Da):   %s   32793.71 (30632.6)  
PI (pH):   %s   8.76 (8.77) Peptide Signal:   %s   cut: 20 range:20-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYISTPLISILAIASTTQALQVSDVQASAAEAKRTVGSIVSGVVDKLTNRQNTCPLVWKEISTTLTAQFLADGQCTDAARAAIRAAFHDCFNGACDGSLILANECSNSENVGLERLCSNLGSLATEKQVGVADLIQFAAAHAIKTCPGGPTVPAKVGRKDSNTANALGILPSGNAKAADLIKLFASKGFSAIDLTALIGAHSTAKQRVTDPSRAGASMDSTPGQWDTKFYSETLKGTAPFTLQSDKNLANSLVTTLPFKTFAASQAAWSAAFVPAMTKMSMLGVSGKLVDCTSALPGGSSKRDVKRSSMFERLGW*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTTCAACTCCCTTAATTTCTATCCTGGCTATTGCTAGCACTACCCAAGCCCTCCAAGTCTCCGATGTGCAGGCATCGGCTGCGGAGGCCAAGCGTACCGTGGGAAGTATCGTA
TCCGGTGTGGTCGACAAGCTCACCAACCGCCAAAATACCTGTCCGCTTGTGTGGAAAGAAATCTCTACCACCCTCACGGCTCAGTTTCTTGCAGACGGCCAGTGTACGGATGCCGCCCGC
GCAGCTATCCGCGCAGCTTTCCACGACTGTTTCAATGGTGCCTGTGACGGCTCCCTCATCCTCGCAAACGAGTGCTCGAACTCCGAGAATGTAGGCCTAGAGAGGCTATGCAGCAATTTA
GGCAGCCTTGCCACCGAAAAGCAAGTCGGTGTAGCTGACCTAATTCAATTCGCTGCCG
GTACGTTCGCCTCCCGTAAACTTTGGCAGGCCTTCCACTAACTTAGTGTGAAGCCCACGCCA
TCAAGACTTGCCCAGGTGGTCCCACTGTCCCCGCCAAAGTCGGCCGTAAAGACTCCAACACTGCCAACGCTCTCGGCATCCTCCCCTCCGGCAACGCCAAAGCCGCCGACCTCATCAAGC
TCTTCGCCTCCAAGGGCTTCTCCGCCATCGATCTCACTGCCCTCATCGGCGCCCACTCCACTGCCAAACAACGTGTCACCGACCCCTCCCGCGCCGGTGCAAGCATGGACTCCACCCCTG
GTCAATGGGACACCAAGTTTTATTCAGAAACTCTCAAGGGTACTGCACCCTTCACGCTTCAGTCTGACAAGAACCTTGCCAACAGCCTGGTCACTACTCTCCCCTTCAAGACCTTTGCGG
CCAGCCAGGCCGCGTGGTCAGCCGCGTTCGTGCCGGCTATGACGAAGATGAGCATGCTGGGTGTGAGTGGGAAGCTTGTGGATTGCACGTCTGCGCTTCCCGGGGGTAGCAGTAAGAGGG
ATGTTAAGCGGTCGTCGATGTTTGAGCGCCTTGGGTGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTTCAACTCCCTTAATTTCTATCCTGGCTATTGCTAGCACTACCCAAGCCCTCCAAGTCTCCGATGTGCAGGCATCGGCTGCGGAGGCCAAGCGTACCGTGGGAAGTATCGTA
TCCGGTGTGGTCGACAAGCTCACCAACCGCCAAAATACCTGTCCGCTTGTGTGGAAAGAAATCTCTACCACCCTCACGGCTCAGTTTCTTGCAGACGGCCAGTGTACGGATGCCGCCCGC
GCAGCTATCCGCGCAGCTTTCCACGACTGTTTCAATGGTGCCTGTGACGGCTCCCTCATCCTCGCAAACGAGTGCTCGAACTCCGAGAATGTAGGCCTAGAGAGGCTATGCAGCAATTTA
GGCAGCCTTGCCACCGAAAAGCAAGTCGGTGTAGCTGACCTAATTCAATTCGCTGCCG
CCCACGCCATCAAGACTTGCCCAGGTGGTCCCACTGTCCCCGCCAAAGTCGGCCGTAAAGAC
TCCAACACTGCCAACGCTCTCGGCATCCTCCCCTCCGGCAACGCCAAAGCCGCCGACCTCATCAAGCTCTTCGCCTCCAAGGGCTTCTCCGCCATCGATCTCACTGCCCTCATCGGCGCC
CACTCCACTGCCAAACAACGTGTCACCGACCCCTCCCGCGCCGGTGCAAGCATGGACTCCACCCCTGGTCAATGGGACACCAAGTTTTATTCAGAAACTCTCAAGGGTACTGCACCCTTC
ACGCTTCAGTCTGACAAGAACCTTGCCAACAGCCTGGTCACTACTCTCCCCTTCAAGACCTTTGCGGCCAGCCAGGCCGCGTGGTCAGCCGCGTTCGTGCCGGCTATGACGAAGATGAGC
ATGCTGGGTGTGAGTGGGAAGCTTGTGGATTGCACGTCTGCGCTTCCCGGGGGTAGCAGTAAGAGGGATGTTAAGCGGTCGTCGATGTTTGAGCGCCTTGGGTGGTAA

Retrieve as FASTA