Entry information : LfluAPx-CcP02
Entry ID 12245
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: LfluAPx-CcP02
Name LfluAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase     [Orthogroup: APx-CcP001]*
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Lentitheciaceae Lentithecium
Organism Lentithecium fluviatile    [TaxId: 690899 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LfluAPx-CcP02
start..stop
S start..stop
GsteAPx-CcP01 911 0 11..849 32..896
GsteAPx-CcP01 302 4e-89 512..848 646..999
AresAPx-CcP01 721 0 6..845 30..934
ApruAPx-CcP02 701 0 11..709 31..763
ApruAPx-CcP02 162 7e-42 614..847 565..763
MbicAPx-CcP01 697 0 6..845 26..940
MbicAPx-CcP01 181 3e-47 607..846 552..797
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 256927..256962 36 N° 2 254903..256863 1961 N° 3 254575..254853 279 N° 4 253887..254160 274
complement(join(253887..254160,254575..254853,254903..256863,256927..256962))


exon

Literature and cross-references LfluAPx-CcP02
DNA ref. JGI genome:   scaffold_17 (256962..253887)
Cluster/Prediction ref. JGI gene:   478443
Protein sequence: LfluAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   849 (826)
PWM (Da):   %s   88258.05 (85627.7)  
PI (pH):   %s   4.84 (4.78) Peptide Signal:   %s   cut: 24 range:24-849
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFTKGSALAFLLDILFLNSGYRARGFATPVTPCSKGVTAGRITAAEWVRTIFHDAVSGNVYTGEGGLDGSIAFELSSSENAGNAFPSSVGMWAPFLSSRTSFADVVAAGIYTAARSCGGPVVPVRGGRVDATTAGPVGAVPQPQNAIGTFRNQFLRLGLDSTGMIQLVACGHSLGGVHASENPLILDAGTAPNDFATMDTSPSTFDSKIASEYVSGTTKNPLVVGKSVSTSRNSDAVVFRSDNNATIRTMQDPTTFSSVCQSLFQKMIEVVPTGVTLTDPITPYEVKPYDVQLTLLAGGTKIQFSGDIRIRTTQRGDIAQVQLVYKDRTGAAVSTSVGTDYKGTASGFDDSFAFFGFSTELPASTSISSFNVIVTVSGGTTQTFDNNGNGFKVDDNIIYQSSQSCLDGSGKLTVVAAVRSGTSTPNLQVVVKNPRASPNPVPSLSTATAAMASQSAVGSYQLYSADYTFSGSQASSASFGVSAGSSSDNYKSTSNLPTACLPLGSSTPTATPSSTAFAFQGCYYDAGAPRALAASATFDEAITVEKCATFCSPYQYFGLEYGRECYCGNTLDATSTIRALSDCNMACGGNSTQTCGAGNRISLYKNLKYSAPVNPQVSGYDYKGCYSEGSAGRALADTATNSDTLTVESCAAFCDGSKYFGVEYGRECYCGATLGEGSVVQPATDCNMLCTGNSTEYCGAGNRLNLYQKVVGSSTPTPTPTPTPTPTPTPSPSPSPSPSPDSTILSSSSSTTPTPTPTPYKGCYTDSVGARVLADAYYFDSQMTVEKCATSCAGAKYFGTQYGGECYCGAELKNPTTKVADTECRMLCGGNSLEYCGNGNRLSMYEKST

Retrieve as FASTA  
Remarks incorrect sequence from genomics (3 introns) missing 5'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCACCAAGGGTTCTGCCCTGGCCTTTCTCCTCGTGTGTCACCAATATGGGGTTGCAGCAGCACCGACTTGGCCTGCATCAACGGACGAGCTCGAGGACATCCTGTTTCTAAACTCC
GGCTATCGTGCCAGAGGATTCGCGACTCCTGTTACCCCCTGTTCGAAAGGAGTTACTGCCGGACGAATCACTGCAGCAGAATGGGTGCGGACTATTTTTCACGATGCAGTCAGCGGCAAC
GTCTATACAGGCGAAGGAGGACTAGATGGCTCAATTGCGTTCGAGCTGTCCAGCAGCGAGAATGCCGGCAACGCTTTCCCCTCTTCGGTCGGAATGTGGGCACCCTTCCTCTCCAGTCGG
ACCTCTTTCGCAGATGTGGTTGCCGCTGGTATCTACACAGCTGCCCGGTCATGTGGCGGTCCTGTGGTTCCGGTCCGTGGTGGTCGAGTCGACGCCACAACAGCAGGGCCTGTGGGAGCA
GTTCCCCAACCTCAGAATGCAATCGGTACCTTCCGGAATCAATTCTTGAGATTGGGTTTGGACAGCACGGGAATGATCCAATTGGTGGCTTGCGGCCATTCTTTGGGTGGCGTACATGCA
TCAGAGAATCCGCTGATTCTGGATGCGGGGACGGCACCTAACGACTTCGCGACTATGGACACCTCACCCTCTACCTTCGATAGCAAGATTGCCAGCGAGTATGTATCTGGTACGACAAAG
AATCCTCTTGTTGTTGGCAAGTCTGTTTCCACTTCTAGAAACTCCGACGCCGTAGTTTTCCGATCGGACAACAACGCCACCATTAGGACTATGCAGGACCCCACCACCTTTTCCAGTGTG
TGTCAGTCGCTCTTCCAGAAGATGATTGAAGTCGTGCCCACGGGCGTTACGCTCACGGATCCTATCACCCCGTATGAAGTCAAGCCCTATGACGTCCAACTTACCCTTCTTGCGGGCGGG
ACGAAGATCCAGTTCTCGGGCGACATCCGGATCCGCACGACTCAGCGTGGAGACATCGCACAAGTCCAACTTGTCTACAAGGACCGCACTGGGGCGGCTGTTTCAACTTCGGTGGGCACC
GACTACAAGGGGACCGCTTCCGGTTTTGACGATAGCTTTGCCTTCTTCGGGTTCTCGACAGAACTTCCTGCTTCCACCTCGATCTCGTCGTTTAACGTCATCGTGACTGTTTCAGGCGGC
ACCACGCAGACGTTCGACAACAACGGCAACGGCTTTAAAGTGGACGACAATATTATCTACCAGTCTTCGCAGAGCTGTCTCGATGGATCTGGCAAGCTCACCGTCGTGGCTGCAGTCCGC
AGCGGCACATCGACCCCAAACCTACAAGTTGTCGTCAAGAATCCCAGGGCTAGCCCGAACCCGGTCCCGTCTCTGTCCACCGCCACTGCGGCGATGGCGTCTCAGTCCGCTGTCGGTTCT
TACCAGCTGTATTCTGCTGACTATACATTTTCCGGCTCGCAAGCTTCGTCTGCCTCGTTTGGTGTTTCCGCAGGCAGCTCGTCAGATAATTACAAGAGCACGAGCAACCTTCCGACAGCT
TGCTTGCCTCTGGGTTCTTCGACCCCTACTGCGACTCCGTCATCCACCGCTTTTGCATTCCAGGGATGCTACTATGATGCTGGTGCTCCTCGTGCCCTCGCAGCCTCGGCCACCTTTGAC
GAAGCTATCACGGTCGAAAAGTGTGCTACCTTCTGTTCGCCGTATCAATACTTTGGTCTTGAATATGGGCGTGAGTGCTACTGCGGCAACACACTCGACGCCACCAGCACCATCAGGGCT
CTGTCAGACTGCAACATGGCGTGCGGCGGTAACTCGACCCAGACTTGCGGCGCCGGTAACCGTATTAGCTTGTACAAGAATTTAAAGTATTCGGCACCTGTCAATCCGCAAGTATCCGGT
TACGACTACAAAGGCTGCTATAGCGAGGGCTCGGCAGGTCGTGCGCTTGCGGACACAGCGACTAACAGTGATACGTTGACGGTGGAGAGCTGTGCAGCCTTCTGTGATGGCTCCAAGTAC
TTTGGTGTAGAGTACGGACG
GTAAGTTGACGTCTGAACGGATGGCAAATTATGTGCTGATTGGTAACAGGGAATGCTACTGTGGAGCAACGCTTGGCGAAGGAAGCGTCGTCCAACCTGC
GACGGACTGCAACATGCTGTGCACTGGCAACAGTACCGAGTACTGCGGTGCCGGCAATCGCCTCAATCTGTACCAAAAGGTGGTTGGATCTTCTACACCCACTCCTACGCCAACGCCTAC
GCCTACGCCAACACCGACTCCGTCGCCGTCGCCATCCCCTTCACCTAGCCCCGACTCCACAATCCTTTCCAGCTCAAGCTCCACAACCCCGACACCAACCCCAACGCC
GTCATCGCCATC
ACCCAGCCCCACCCTCGCCTCCTCGACCCCCTTGTCAAGCTCCACTCCAAGCCCAACGCCAACCCCCACCGGGCCTTCCTTCACCGCCTACAACTACGTCGGGTGCCTCAGCGACGACGT
AGCAAACCGCACCCTAGTAGGCCAATCAAGAAGTACATCCGACAACGCCTACGCATCCTGCGCCTCCTACTGCAGCGGCTACCAGTACTTCGGCGTCGAGTACAGCACCGAATGCTACTG
CGCCAACGCCCTCGAATACATCACCAAAAACTCCGACTCCACCTGCAGCATGCAGTGTTCTGGAAACAGCACACAAGTCTGCGGCGGGCCCTCGCTCATTACGGTGTTCAACAGCACACG
CGCTGTCCAACAGCCTTCCAACCCCGCGATCCCGAACTACAGCTACAAGGGTTGCTACACAGATAGCGTGGGGGCGCGCGTGCTTGCCGACGCATATTACTTCGATTCGCAAATGACGGT
GGAGAAGTGCGCGACGAGCTGTGCCGGGGCGAAGTATTTTGGTACACAGTATGGAGGCGAGTGCTATTGCGGGGCGGAACTCAAGAATCCGACGACCAAGGTGGCGGATACGGAGTGCAG
GATGCTTTGCGGCGGGAATAGCTTGGAATACTGCGGGAATGGGAATCGCTTGAGTATGTACGAGAAGAGTACTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCACCAAGGGTTCTGCCCTGGCCTTTCTCCTCGACATCCTGTTTCTAAACTCCGGCTATCGTGCCAGAGGATTCGCGACTCCTGTTACCCCCTGTTCGAAAGGAGTTACTGCCGGA
CGAATCACTGCAGCAGAATGGGTGCGGACTATTTTTCACGATGCAGTCAGCGGCAACGTCTATACAGGCGAAGGAGGACTAGATGGCTCAATTGCGTTCGAGCTGTCCAGCAGCGAGAAT
GCCGGCAACGCTTTCCCCTCTTCGGTCGGAATGTGGGCACCCTTCCTCTCCAGTCGGACCTCTTTCGCAGATGTGGTTGCCGCTGGTATCTACACAGCTGCCCGGTCATGTGGCGGTCCT
GTGGTTCCGGTCCGTGGTGGTCGAGTCGACGCCACAACAGCAGGGCCTGTGGGAGCAGTTCCCCAACCTCAGAATGCAATCGGTACCTTCCGGAATCAATTCTTGAGATTGGGTTTGGAC
AGCACGGGAATGATCCAATTGGTGGCTTGCGGCCATTCTTTGGGTGGCGTACATGCATCAGAGAATCCGCTGATTCTGGATGCGGGGACGGCACCTAACGACTTCGCGACTATGGACACC
TCACCCTCTACCTTCGATAGCAAGATTGCCAGCGAGTATGTATCTGGTACGACAAAGAATCCTCTTGTTGTTGGCAAGTCTGTTTCCACTTCTAGAAACTCCGACGCCGTAGTTTTCCGA
TCGGACAACAACGCCACCATTAGGACTATGCAGGACCCCACCACCTTTTCCAGTGTGTGTCAGTCGCTCTTCCAGAAGATGATTGAAGTCGTGCCCACGGGCGTTACGCTCACGGATCCT
ATCACCCCGTATGAAGTCAAGCCCTATGACGTCCAACTTACCCTTCTTGCGGGCGGGACGAAGATCCAGTTCTCGGGCGACATCCGGATCCGCACGACTCAGCGTGGAGACATCGCACAA
GTCCAACTTGTCTACAAGGACCGCACTGGGGCGGCTGTTTCAACTTCGGTGGGCACCGACTACAAGGGGACCGCTTCCGGTTTTGACGATAGCTTTGCCTTCTTCGGGTTCTCGACAGAA
CTTCCTGCTTCCACCTCGATCTCGTCGTTTAACGTCATCGTGACTGTTTCAGGCGGCACCACGCAGACGTTCGACAACAACGGCAACGGCTTTAAAGTGGACGACAATATTATCTACCAG
TCTTCGCAGAGCTGTCTCGATGGATCTGGCAAGCTCACCGTCGTGGCTGCAGTCCGCAGCGGCACATCGACCCCAAACCTACAAGTTGTCGTCAAGAATCCCAGGGCTAGCCCGAACCCG
GTCCCGTCTCTGTCCACCGCCACTGCGGCGATGGCGTCTCAGTCCGCTGTCGGTTCTTACCAGCTGTATTCTGCTGACTATACATTTTCCGGCTCGCAAGCTTCGTCTGCCTCGTTTGGT
GTTTCCGCAGGCAGCTCGTCAGATAATTACAAGAGCACGAGCAACCTTCCGACAGCTTGCTTGCCTCTGGGTTCTTCGACCCCTACTGCGACTCCGTCATCCACCGCTTTTGCATTCCAG
GGATGCTACTATGATGCTGGTGCTCCTCGTGCCCTCGCAGCCTCGGCCACCTTTGACGAAGCTATCACGGTCGAAAAGTGTGCTACCTTCTGTTCGCCGTATCAATACTTTGGTCTTGAA
TATGGGCGTGAGTGCTACTGCGGCAACACACTCGACGCCACCAGCACCATCAGGGCTCTGTCAGACTGCAACATGGCGTGCGGCGGTAACTCGACCCAGACTTGCGGCGCCGGTAACCGT
ATTAGCTTGTACAAGAATTTAAAGTATTCGGCACCTGTCAATCCGCAAGTATCCGGTTACGACTACAAAGGCTGCTATAGCGAGGGCTCGGCAGGTCGTGCGCTTGCGGACACAGCGACT
AACAGTGATACGTTGACGGTGGAGAGCTGTGCAGCCTTCTGTGATGGCTCCAAGTACTTTGGTGTAGAGTACGGACG
GGAATGCTACTGTGGAGCAACGCTTGGCGAAGGAAGCGTCGTC
CAACCTGCGACGGACTGCAACATGCTGTGCACTGGCAACAGTACCGAGTACTGCGGTGCCGGCAATCGCCTCAATCTGTACCAAAAGGTGGTTGGATCTTCTACACCCACTCCTACGCCA
ACGCCTACGCCTACGCCAACACCGACTCCGTCGCCGTCGCCATCCCCTTCACCTAGCCCCGACTCCACAATCCTTTCCAGCTCAAGCTCCACAACCCCGACACCAACCCCAACGCC
CTAC
AAGGGTTGCTACACAGATAGCGTGGGGGCGCGCGTGCTTGCCGACGCATATTACTTCGATTCGCAAATGACGGTGGAGAAGTGCGCGACGAGCTGTGCCGGGGCGAAGTATTTTGGTACA
CAGTATGGAGGCGAGTGCTATTGCGGGGCGGAACTCAAGAATCCGACGACCAAGGTGGCGGATACGGAGTGCAGGATGCTTTGCGGCGGGAATAGCTTGGAATACTGCGGGAATGGGAAT
CGCTTGAGTATGTACGAGAAGAGTACTTGA

Retrieve as FASTA