Entry information : DexiCIIAA02
Entry ID 12250
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: DexiCIIAA02
Name DexiCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Didymellaceae Didymella
Organism Didymella exigua    [TaxId: 100019 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DexiCIIAA02
start..stop
S start..stop
CberCIIAA01 480 4e-170 24..386 6..399
Ssrc1lsm3aCIIAA02 477 5e-169 24..381 6..396
COsaCIIAA05 470 3e-166 24..386 6..399
CheCIIAA05_C5 470 3e-166 24..386 6..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29334..29393 60 N° 2 28744..29150 407 N° 3 28657..28696 40 N° 4 28091..28596 506
N° 5 27885..28056 172  
complement(join(27885..28056,28091..28596,28657..28696,28744..29150,29334..29393 ))


exon

Literature and cross-references DexiCIIAA02
DNA ref. JGI genome:   scaffold_55 (29393..27885)
Cluster/Prediction ref. JGI gene:   104652
Protein sequence: DexiCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   395
PWM (Da):   %s   42482.19  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYCGARAYPIAGSYSPDPRFGFLYLSYALLTLVSFSNARPGMGDTVAAMRREANKVKRAESKQLIGDLRTLKDTQLASIGKDIKAILLSQPNAESNIIDTSIPAGSLGSAACKADLCCDWKRISYEMTAKSNGTSGRCTKLARQAVRLGFHDAGVCCADNNGLAAIADLIWYKNMQTWYKKYPPHGVGMADLIQMGANVANVICPLGPRIRSFVGRKDNSRAGPTGLLPGYTDSAGTLLKLFAAKTIDAHDLVALVGAHTTSQQHSVDHTREGDPQDSTPGIWDIESYSETTGAAAPRVLRPASDINLSEDPRPAPEWADFSDPSSGQEHWNDDYAPWESTKVLPPHRARYVAPDQPILDLWLQGQFDQLNNLVDDAVMLTDVGAGGSGTVIIP*

Retrieve as FASTA  
Remarks incorrect sequence from genomics (4 introns) 5' end overpredicted
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATTGCGGTGCCAGAGCATACCCTATTGCGGGGTCGTATTCGCCAGACCCCAGGTTTGTGAGTGATCTAGATCTCCACATGTTCTTGAGAGTCCATGAGGCGTCATGGACGGTCGTG
TGTAAATGGCATGGACAGTCGTGTGTAAAAGGCATGGACAGTCGTGTGTAAAAGGTAGTGCGTGGAGCGCACCACAAGGTATCCCTCTATCCCACGTCTCTCCCCTACTTGCCCGTTATC
AAGGGCTTCCTATATCTGAGTTATGCGCTTCTCACTCTTGTCTCCTTCTCTAATGCTCGCCCCGGCATGGGCGACACCGTGGCAGCAATGCGGCGCGAAGCTAACAAAGTCAAGCGCGCA
GAGTCCAAGCAGCTCATCGGCGACCTGCGGACGCTCAAAGACACGCAATTGGCCTCCATTGGCAAAGACATCAAAGCCATCCTCCTCAGCCAGCCCAACGCCGAATCCAACATCATCGAC
ACGTCTATCCCCGCCGGGTCTCTTGGCAGCGCAGCTTGCAAAGCTGACCTCTGCTGCGACTGGAAGCGGATCAGCTACGAGATGACGGCAAAGTCCAACGGCACATCCGGGCGCTGCACC
AAACTCGCCCGTCAAGCAGTCCGCCTCGGCTTCCACGACGCAGGCGTCTG
GTCAAATCATCCGCCGACGGCTCCATTCTGCTCACCGACGAAATCAGCTGCGCAGACAACAACGGCCTCG
CCGCCATCGCAGACCTG
GTACATGAATATGCAGACCTGGTACAAGAAATACGCAAACCTGGTACAACAAATACGCAGATCTGGTACAAGAATATGCAGACCTGGTACAAGAAATACCCCC
CCCACGGCGTCGGCATGGCAGACCTCATCCAAATGGGTGCCAACGTCGCCAACGTCATATGTCCCCTCGGGCCGCGCATACGCTCCTTCGTCGGGCGCAAGGACAACAGCCGCGCCGGAC
CCACAGGCCTGCTACCAGGCTACACCGACTCAGCAGGCACTCTGCTCAAGCTATTCGCAGCCAAGACAATCGACGCCCACGACCTCGTCGCCCTGGTCGGCGCACACACCACATCTCAAC
AGCACTCCGTCGACCATACGCGCGAAGGCGACCCCCAGGACAGCACGCCGGGGATCTGGGATATAGAATCCTACTCCGAGACCACGGGCGCCGCGGCCCCGCGCGTCCTGCGCCCCGCAT
CCGACATCAACCTGTCCGAGGATCCGCGGCCCGCGCCCGAGTGGGCCGACTTCAGCGACCCCAGCTCCGGACAGGAGCACTGGAACGACGACTACGCGCCTTG
GTCTGCTGGGCATGGCG
AATATTAACGACCTCAGGGAGAGCACAAAGGTGCTGCCGCCACATCGCGCGAGGTATGTTGCGCCTGACCAGCCGATTTTGGACTTGTGGCTGCAAGGGCAGTTTGATCAGCTGAATAAT
TTGGTCGACGATGCAGTTATGCTTACGGACGTTGGTGCGGGAGGGAGTGGGACGGTCATCATCCCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATTGCGGTGCCAGAGCATACCCTATTGCGGGGTCGTATTCGCCAGACCCCAGGTTTGGCTTCCTATATCTGAGTTATGCGCTTCTCACTCTTGTCTCCTTCTCTAATGCTCGCCCC
GGCATGGGCGACACCGTGGCAGCAATGCGGCGCGAAGCTAACAAAGTCAAGCGCGCAGAGTCCAAGCAGCTCATCGGCGACCTGCGGACGCTCAAAGACACGCAATTGGCCTCCATTGGC
AAAGACATCAAAGCCATCCTCCTCAGCCAGCCCAACGCCGAATCCAACATCATCGACACGTCTATCCCCGCCGGGTCTCTTGGCAGCGCAGCTTGCAAAGCTGACCTCTGCTGCGACTGG
AAGCGGATCAGCTACGAGATGACGGCAAAGTCCAACGGCACATCCGGGCGCTGCACCAAACTCGCCCGTCAAGCAGTCCGCCTCGGCTTCCACGACGCAGGCGTCTG
CTGCGCAGACAAC
AACGGCCTCGCCGCCATCGCAGACCTG
ATCTGGTACAAGAATATGCAGACCTGGTACAAGAAATACCCCCCCCACGGCGTCGGCATGGCAGACCTCATCCAAATGGGTGCCAACGTCGCC
AACGTCATATGTCCCCTCGGGCCGCGCATACGCTCCTTCGTCGGGCGCAAGGACAACAGCCGCGCCGGACCCACAGGCCTGCTACCAGGCTACACCGACTCAGCAGGCACTCTGCTCAAG
CTATTCGCAGCCAAGACAATCGACGCCCACGACCTCGTCGCCCTGGTCGGCGCACACACCACATCTCAACAGCACTCCGTCGACCATACGCGCGAAGGCGACCCCCAGGACAGCACGCCG
GGGATCTGGGATATAGAATCCTACTCCGAGACCACGGGCGCCGCGGCCCCGCGCGTCCTGCGCCCCGCATCCGACATCAACCTGTCCGAGGATCCGCGGCCCGCGCCCGAGTGGGCCGAC
TTCAGCGACCCCAGCTCCGGACAGGAGCACTGGAACGACGACTACGCGCCTTG
GGAGAGCACAAAGGTGCTGCCGCCACATCGCGCGAGGTATGTTGCGCCTGACCAGCCGATTTTGGAC
TTGTGGCTGCAAGGGCAGTTTGATCAGCTGAATAATTTGGTCGACGATGCAGTTATGCTTACGGACGTTGGTGCGGGAGGGAGTGGGACGGTCATCATCCCGTGA

Retrieve as FASTA