Entry information : DexiCIIAB02
Entry ID 12259
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: DexiCIIAB02
Name DexiCIIAB02
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Didymellaceae Didymella
Organism Didymella exigua    [TaxId: 100019 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DexiCIIAB02
start..stop
S start..stop
AbraCIIAB01 473 1e-169 1..318 1..327
AalteCIIAB02 462 2e-165 1..318 1..327
CberCIIAB01 444 2e-158 1..318 1..316
PnoCIIAB01 434 1e-154 51..318 34..302
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49023..49584 562 N° 2 49635..50026 392  
join(49023..49584,49635..50026)


exon

Literature and cross-references DexiCIIAB02
DNA ref. JGI genome:   scaffold_20 (49023..50026)
Cluster/Prediction ref. JGI gene:   422317
Protein sequence: DexiCIIAB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (299)
PWM (Da):   %s   33686.95 (31553.9)  
PI (pH):   %s   8.22 (7.99) Peptide Signal:   %s   cut: 20 range:20-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYISHIFVTALAAASTAQAFSIQEEAHNANEVSKRTLGNLLSLLSGLIGGNKQSTACPAVWNQISTQLTEQFLADGQCTDAARAAIRSSFHDCFNGACDGSLILADECSNQENRGLERLCGNLKTVQANTGVGMADLIQFAAAHGVKTCPGGPTVPVKVGRKDSSIANALGVLPNGQAQSGDLIKLFASKGFSPVDLAALLGAHTAAKQRVTAPESPEDLDSTVGRWDNKYFSETRSGKAPFTLPSDKSVAQNPLTMIPFNTFALSKGAWDVAFVSAMQRMSMLGVNQKGLIDCTSALPGGSRKRDVRNSNLFDRLKW*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACATCTCTCACATCTTCGTAACTGCACTGGCGGCCGCCAGCACTGCACAAGCCTTCAGTATCCAGGAAGAAGCACACAACGCCAATGAGGTTTCCAAGCGCACACTTGGAAATCTC
TTAAGCTTACTCTCTGGCCTCATCGGAGGCAACAAGCAGTCTACAGCATGCCCTGCTGTCTGGAATCAGATATCCACCCAGCTCACCGAGCAATTTTTGGCAGATGGCCAGTGCACAGAT
GCCGCTCGCGCCGCCATCCGTTCGTCCTTCCACGACTGCTTCAACGGCGCTTGCGATGGATCTCTGATCCTCGCTGATGAGTGCTCGAATCAAGAGAACAGGGGCCTCGAGCGTCTCTGT
GGAAACCTCAAGACCGTACAGGCCAATACCGGTGTCGGCATGGCCGATCTCATTCAGTTCGCCGCTGCACACGGCGTCAAGACCTGCCCTGGAGGACCTACCGTCCCTGTCAAAGTCGGG
CGCAAAGATTCCAGCATCGCAAATGCTCTCGGCGTACTTCCGAATGGCCAAGCTCAGAGCGGCGATCTCATCAAGCTCTTCG
GTAAGCACACTCAAACCATATATGCTCATGTCCATGCT
AAGAAACTCCAGCATCCAAAGGCTTCTCACCTGTTGATCTTGCCGCCCTCCTCGGCGCCCACACCGCCGCAAAGCAGCGTGTCACCGCTCCGGAGTCGCCAGAAGACCTCGACTCCACAG
TCGGTAGATGGGACAACAAATACTTCTCGGAGACTAGGAGTGGCAAGGCACCTTTTACGCTACCCTCGGACAAGAGCGTTGCGCAGAACCCCCTTACTATGATTCCATTCAACACCTTTG
CGCTGAGCAAGGGTGCATGGGATGTTGCTTTCGTCAGCGCCATGCAGAGGATGAGCATGCTGGGCGTTAATCAGAAGGGTCTGATCGACTGCACGTCTGCCCTGCCCGGTGGTTCGAGGA
AGAGGGACGTACGCAACAGCAATCTTTTCGACAGGCTCAAGTGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACATCTCTCACATCTTCGTAACTGCACTGGCGGCCGCCAGCACTGCACAAGCCTTCAGTATCCAGGAAGAAGCACACAACGCCAATGAGGTTTCCAAGCGCACACTTGGAAATCTC
TTAAGCTTACTCTCTGGCCTCATCGGAGGCAACAAGCAGTCTACAGCATGCCCTGCTGTCTGGAATCAGATATCCACCCAGCTCACCGAGCAATTTTTGGCAGATGGCCAGTGCACAGAT
GCCGCTCGCGCCGCCATCCGTTCGTCCTTCCACGACTGCTTCAACGGCGCTTGCGATGGATCTCTGATCCTCGCTGATGAGTGCTCGAATCAAGAGAACAGGGGCCTCGAGCGTCTCTGT
GGAAACCTCAAGACCGTACAGGCCAATACCGGTGTCGGCATGGCCGATCTCATTCAGTTCGCCGCTGCACACGGCGTCAAGACCTGCCCTGGAGGACCTACCGTCCCTGTCAAAGTCGGG
CGCAAAGATTCCAGCATCGCAAATGCTCTCGGCGTACTTCCGAATGGCCAAGCTCAGAGCGGCGATCTCATCAAGCTCTTCG
CATCCAAAGGCTTCTCACCTGTTGATCTTGCCGCCCTC
CTCGGCGCCCACACCGCCGCAAAGCAGCGTGTCACCGCTCCGGAGTCGCCAGAAGACCTCGACTCCACAGTCGGTAGATGGGACAACAAATACTTCTCGGAGACTAGGAGTGGCAAGGCA
CCTTTTACGCTACCCTCGGACAAGAGCGTTGCGCAGAACCCCCTTACTATGATTCCATTCAACACCTTTGCGCTGAGCAAGGGTGCATGGGATGTTGCTTTCGTCAGCGCCATGCAGAGG
ATGAGCATGCTGGGCGTTAATCAGAAGGGTCTGATCGACTGCACGTCTGCCCTGCCCGGTGGTTCGAGGAAGAGGGACGTACGCAACAGCAATCTTTTCGACAGGCTCAAGTGG

Retrieve as FASTA