Entry information : ApruCcP01
Entry ID 12272
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ApruCcP01
Name ApruCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Aplosporella
Organism Aplosporella prunicola    [TaxId: 462254 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ApruCcP01
start..stop
S start..stop
BdotCcP01 582 0 1..393 1..371
HpulCcP02 530 0 1..393 1..368
XhevCcP01 529 0 1..393 1..370
LpaluCcP02 526 0 1..393 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 734637..735106 470 N° 2 735218..735929 712  
join(734637..735106,735218..735929)


exon

Literature and cross-references ApruCcP01
DNA ref. JGI genome:   scaffold_11 (734637..735929)
Cluster/Prediction ref. JGI gene:   249399
Protein sequence: ApruCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   394
PWM (Da):   %s   43004.29  
PI (pH):   %s   9.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAARTVFARSAALRTTASPLTTATTTAARAPRLSSNLTRRAIRYQHQSRRGYASEGGSNPNPSSSSGSNPAIWLGALAVLGGAGYWGYSSGMLRGTSSSEQGVGAAVKGAAFTPKTEDFQAVYDAVAKALEEHDDYDDGSYGPVLLRLGWHASGTFDKETGTGGSNGATMRFPPEGDHGANAGLRAARDFLEPIRARFPWITFSDLWTLAAVCAIQEMQGPKIPWRPGRQDRDVSFCTPDGRLPDASQGHDHLRAIFGRMGFNDQEIVALSGAHALGRCHTDRSGFEGPWTFSPTTLTNDYFRLLLDERWSYRKWDGPRQFQDSKTKSLMMLPTDMALVKDKKFRPVVERYAKDNEAFFKDFADVVMRLFELGVPFATGEDARIVFKSSFD

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGCCGCCAGGACCGTCTTCGCCCGCAGCGCCGCCCTGCGCACCACTGCCTCTCCTCTCACCACCGCCACCACCACTGCAGCCCGCGCTCCTCGCCTCAGCAGCAACCTCACC
CGCCGCGCCATCCGGTACCAGCACCAATCGCGGCGGGGCTACGCCTCAGAGGGCGGGAGCAACCCCAACCCCAGCAGCAGCAGTGGCAGCAACCCCGCCATATGGCTCGGCGCGCTGGCC
GTGCTGGGCGGCGCCGGCTACTGGGGCTACAGCTCGGGCATGCTGCGGGGGACGTCGAGCTCGGAGCAGGGCGTCGGCGCCGCAGTGAAAGGCGCCGCCTTCACGCCCAAGACGGAGGAC
TTCCAGGCCGTGTATGACGCCGTGGCGAAGGCTTTGGAGGAGCACGACGACTATGACGATGGCAGCTATGGGCCTGTGTTGTTGAGGCTGGGCTGGCATGCTAGTGGCAC
GTGAGTCTTG
CTTTTCTTGTTGTTGGCCTTTCAGTGAGGAAGAGGGAGAAGAGGAAGCTGCATGTCTTGTTTGACAGAGGACGAAGCTGTACTGACACACTTCTCCTACAGCTTCGACAAGGAAACCGGC
ACCGGCGGCTCCAACGGCGCAACCATGCGCTTCCCACCGGAAGGCGACCACGGGGCGAACGCCGGACTGCGCGCGGCGCGCGACTTCCTCGAGCCCATCCGGGCGCGCTTCCCGTGGATC
ACGTTCTCCGACCTGTGGACGCTAGCGGCAGTGTGCGCGATCCAAGAAATGCAAGGGCCGAAGATCCCCTGGCGGCCCGGCCGGCAAGACCGGGACGTGTCGTTCTGCACGCCGGACGGG
CGGCTCCCCGACGCGTCGCAGGGCCACGACCACCTGCGCGCCATCTTCGGCCGCATGGGCTTCAACGACCAAGAGATTGTGGCGCTGAGCGGCGCGCACGCGCTCGGCCGCTGCCACACC
GACCGCTCCGGCTTCGAGGGCCCCTGGACCTTCTCCCCGACGACCCTCACCAACGACTACTTCAGGTTGCTGCTCGATGAGCGCTGGTCTTACCGCAAGTGGGACGGCCCCCGCCAGTTC
CAGGATAGTAAGACCAAGAGCCTTATGATGCTGCCCACGGATATGGCGCTCGTCAAGGATAAGAAGTTCCGTCCGGTCGTCGAGCGCTATGCCAAGGATAACGAGGCCTTCTTCAAGGAC
TTTGCCGATGTCGTGATGCGCCTGTTTGAGCTGGGCGTGCCGTTTGCGACGGGCGAGGACGCGCGCATCGTGTTCAAGAGCAGCTTTGACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGCCGCCAGGACCGTCTTCGCCCGCAGCGCCGCCCTGCGCACCACTGCCTCTCCTCTCACCACCGCCACCACCACTGCAGCCCGCGCTCCTCGCCTCAGCAGCAACCTCACC
CGCCGCGCCATCCGGTACCAGCACCAATCGCGGCGGGGCTACGCCTCAGAGGGCGGGAGCAACCCCAACCCCAGCAGCAGCAGTGGCAGCAACCCCGCCATATGGCTCGGCGCGCTGGCC
GTGCTGGGCGGCGCCGGCTACTGGGGCTACAGCTCGGGCATGCTGCGGGGGACGTCGAGCTCGGAGCAGGGCGTCGGCGCCGCAGTGAAAGGCGCCGCCTTCACGCCCAAGACGGAGGAC
TTCCAGGCCGTGTATGACGCCGTGGCGAAGGCTTTGGAGGAGCACGACGACTATGACGATGGCAGCTATGGGCCTGTGTTGTTGAGGCTGGGCTGGCATGCTAGTGGCAC
CTTCGACAAG
GAAACCGGCACCGGCGGCTCCAACGGCGCAACCATGCGCTTCCCACCGGAAGGCGACCACGGGGCGAACGCCGGACTGCGCGCGGCGCGCGACTTCCTCGAGCCCATCCGGGCGCGCTTC
CCGTGGATCACGTTCTCCGACCTGTGGACGCTAGCGGCAGTGTGCGCGATCCAAGAAATGCAAGGGCCGAAGATCCCCTGGCGGCCCGGCCGGCAAGACCGGGACGTGTCGTTCTGCACG
CCGGACGGGCGGCTCCCCGACGCGTCGCAGGGCCACGACCACCTGCGCGCCATCTTCGGCCGCATGGGCTTCAACGACCAAGAGATTGTGGCGCTGAGCGGCGCGCACGCGCTCGGCCGC
TGCCACACCGACCGCTCCGGCTTCGAGGGCCCCTGGACCTTCTCCCCGACGACCCTCACCAACGACTACTTCAGGTTGCTGCTCGATGAGCGCTGGTCTTACCGCAAGTGGGACGGCCCC
CGCCAGTTCCAGGATAGTAAGACCAAGAGCCTTATGATGCTGCCCACGGATATGGCGCTCGTCAAGGATAAGAAGTTCCGTCCGGTCGTCGAGCGCTATGCCAAGGATAACGAGGCCTTC
TTCAAGGACTTTGCCGATGTCGTGATGCGCCTGTTTGAGCTGGGCGTGCCGTTTGCGACGGGCGAGGACGCGCGCATCGTGTTCAAGAGCAGCTTTGACTAG

Retrieve as FASTA